Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU131361

Sigma-Aldrich

MISSION® esiRNA

targeting human ITLN1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AACAGCTCCCTGCTGAGGTACCGCACGGACACTGGCTTCCTCCAGACACTGGGACATAATCTGTTTGGCATCTACCAGAAATATCCAGTGAAATATGGAGAAGGAAAGTGTTGGACTGACAACGGCCCGGTGATCCCTGTGGTCTATGATTTTGGCGACGCCCAGAAAACAGCATCTTATTACTCACCCTATGGCCAGCGGGAATTCACTGCGGGATTTGTTCAGTTCAGGGTATTTAATAACGAGAGAGCAGCCAACGCCTTGTGTGCTGGAATGAGGGTCACCGGATGTAACACTGAGCACCACTGCATTGGTGGAGGAGGATACTTTCCAGAGGCCAGTCCCCAGCAGTGTGGAGATTTTTCTGGTTTTGATTGGAGTGGATATGGAACTCATGTTGGTTACAGCAGCAGCCGTGAGATAACTGAGGCAGCTGTGCTTCTATTCTATCGTTGAGAGTTTTGTGGGAGGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Narutaka Katsuya et al.
Pathology international, 70(12), 943-952 (2020-10-02)
Intelectin-1 (ITLN1) is an adipokine with an anti-inflammatory function that is involved in neoplastic diseases such as pleural mesothelioma and gastric and prostate cancers. However, the expression and function of ITLN1 in colorectal cancer (CRC) remain unknown. To identify novel
L Yi et al.
Mucosal immunology, 10(6), 1491-1503 (2017-02-23)
The epithelial and epidermal innate cytokines IL-25, IL-33, and thymic stromal lymphopoietin (TSLP) have pivotal roles in the initiation of allergic inflammation in asthma and atopic dermatitis (AD). However, the mechanism by which the expression of these innate cytokines is
Dan Li et al.
Oncotarget, 6(18), 16168-16182 (2015-05-13)
Recent evidence shows the emerging roles of intelectin 1 (ITLN1), a secretory lectin, in human cancers. Our previous studies have implicated the potential roles of ITLN1 in the aggressiveness of gastric cancer. Herein, we investigated the functions, downstream targets, and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique