Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU131141

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGCCTCTGATTGGCACAGTGCTGGCCATGGACCCTGATGCGGCTAGGCATAGCATTGGATACTCCATCCGCAGGACCAGTGACAAGGGCCAGTTCTTCCGAGTCACAAAAAAGGGGGACATTTACAATGAGAAAGAACTGGACAGAGAAGTCTACCCCTGGTATAACCTGACTGTGGAGGCCAAAGAACTGGATTCCACTGGAACCCCCACAGGAAAAGAATCCATTGTGCAAGTCCACATTGAAGTTTTGGATGAGAATGACAATGCCCCGGAGTTTGCCAAGCCCTACCAGCCCAAAGTGTGTGAGAACGCTGTCCATGGCCAGCTGGTCCTGCAGATCTCCGCAATAGACAAGGACATAACACCACGAAACGTGAAGTTCAAATTCATCTTGAATACTGAGAACAACTTTACCCTCACGGATAATCACGATAACACGGCCAACATCACAGTCAAGTATGGGCAGTTTGACCG

Numéro d'accès Ensembl | humain

ENSG00000179776

Numéro d'accès NCBI

NM_001795

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CDH5(1003) , CDH5(1003)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhiyong Wu et al.
American journal of translational research, 8(10), 4310-4319 (2016-11-11)
Angiotensin II (AngII) involved in the pathogenesis of pulmonary injury through impairing the integrity of pulmonary microvascular endothelial barrier, but the mechanism is still not clear. We aim to determine the roles of VE-cadherin, playing crucial roles in the adhesion
Miwa Sato et al.
PloS one, 10(9), e0137301-e0137301 (2015-09-04)
We developed a microfluidic model of microcirculation containing both blood and lymphatic vessels for examining vascular permeability. The designed microfluidic device harbors upper and lower channels that are partly aligned and are separated by a porous membrane, and on this
Natalia Colás-Algora et al.
Cellular and molecular life sciences : CMLS, 77(11), 2125-2140 (2019-08-10)
VE-cadherin plays a central role in controlling endothelial barrier function, which is transiently disrupted by proinflammatory cytokines such as tumor necrosis factor (TNFα). Here we show that human endothelial cells compensate VE-cadherin degradation in response to TNFα by inducing VE-cadherin

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique