Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU130641

Sigma-Aldrich

MISSION® esiRNA

targeting human SORT1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTCCTGGGTTGGAGATAGCACTGGGGTCATTCTAGTCTTGACTACCTTCCATGTACCACTGGTAATTATGACTTTTGGACAGTCCAAGCTATATCGAAGTGAGGATTATGGGAAGAACTTTAAGGATATTACAGATCTCATCAATAACACCTTTATTCGGACTGAATTTGGCATGGCTATTGGTCCTGAGAACTCTGGAAAGGTGGTGTTAACAGCAGAGGTGTCTGGAGGAAGTCGTGGAGGAAGAATCTTTAGATCATCAGATTTTGCGAAGAATTTTGTGCAAACAGATCTCCCTTTTCATCCTCTCACTCAGATGATGTATAGCCCTCAGAATTCTGATTATCTTTTAGCTCTCAGCACTGAAAATGGCCTGTGGGTGTCCAAGAATTTTGGGGGAAAATGGGAAGAAATCCACAAAGCAGTATGTTTGGCCAAATGGGGATCAGACAACACCATCTTCTTTACAACCTATGCAAATGGCTCCTG

Numéro d'accès Ensembl | humain

ENSG00000134243

Numéro d'accès NCBI

NM_002959

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SORT1(6272) , SORT1(6272)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yuncheng Lv et al.
Acta biochimica et biophysica Sinica, 51(5), 471-483 (2019-04-06)
Sortilin is closely associated with hyperlipidemia and the risk of atherosclerosis (AS). The role of sortilin and the underlying mechanism in peripheral macrophage are not fully understood. In this study, we investigated the effect of macrophage sortilin on ATP-binding cassette
Swati Venkat et al.
Molecular biology of the cell, 28(19), 2569-2578 (2017-08-05)
Elevated, nontoxic doses of manganese (Mn) protect against Shiga toxin-1-induced cell death via down-regulation of GPP130, a cycling Golgi membrane protein that serves as an endosome-to-Golgi trafficking receptor for the toxin. Mn binds to GPP130 in the Golgi and causes
Keiji Uchiyama et al.
PLoS pathogens, 13(6), e1006470-e1006470 (2017-07-01)
Prion diseases are a group of fatal neurodegenerative disorders caused by prions, which consist mainly of the abnormally folded isoform of prion protein, PrPSc. A pivotal pathogenic event in prion disease is progressive accumulation of prions, or PrPSc, in brains
Hye Youn Sung et al.
Journal of stroke, 20(3), 350-361 (2018-10-13)
The pathogenesis of moyamoya disease (MMD) remains poorly understood, and no reliable molecular biomarkers for MMD have been identified to date. The present study aimed to identify epigenetic biomarkers for use in the diagnosis of MMD. We performed integrated analyses
Fangfang Gao et al.
The American journal of pathology, 190(9), 1931-1942 (2020-06-12)
Pancreatic cancer has a dismal prognosis, and there is no targeted therapy against this malignancy. The neuronal membrane protein sortilin is emerging as a regulator of cancer cell development, but its expression and impact in pancreatic cancer are unknown. This
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique