Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU124091

Sigma-Aldrich

MISSION® esiRNA

targeting human FGF5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATTCTTTCCACTGAATGCATAATGTTTAAATAGCATAAAATGAAATGCTACAAAAATTGAACTAATTTATACTTTAAAGTATTTCTGGGTTAAATGAAACAATGAAATTTTTTAGTATGTTCAACTCTCATCCAAATGGCATATGACCCTGTTTACACAGCCTAAAGCTAAAAATATTACTCTAGTTTATTCTAATCTATTGTTAAGTATTGTGCACTGTATACCAAGTTCTTAGGGCACATGAAAAATTTTAGCTGCCAAACAGGAACTAGTAAACATATGTTCCTAATAAGTGAAGGGAAAGATAATAATGATGGTCAACAATAAGCCACGTCAATGCATAAGTTGTATAGGCTAAATGTTGCTTGTAGGCTACATTAAACTCAAATGTAATAGTTTATCTTATACTCCTGGTTTGATTTGATTAGCA

Numéro d'accès Ensembl | humain

ENSG00000138675

Numéro d'accès NCBI

NM_004464

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FGF5(2250) , FGF5(2250)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sara Ghassemi et al.
Oncotarget, 8(50), 87750-87762 (2017-11-21)
Although FGF5 mRNA was previously found expressed in some melanoma cell lines in contrast to normal human melanocytes, neither its contribution to melanoma growth nor its expression in melanoma tissue has been investigated. Here we demonstrate that ectopic overexpression of
Zheng Zhu et al.
Oncology reports, 45(2), 501-512 (2021-01-09)
Hsa_circ_0016760 expression has been reported to be increased in non‑small cell lung cancer (NSCLC). The present study was designed to explore the role and mechanism of hsa_circ_0016760 in regulating NSCLC progression. In total, 60NSCLC patients were followed‑up for 60 months after surgery.
Yanjuan Zhou et al.
Journal of cellular biochemistry (2018-12-07)
The morbidity and mortality rates of nonsmall-cell lung cancer (NSCLC) have increased in recent years. We aimed to explore the biological role of fibroblast growth factor 5 (FGF5) in NSCLC. We first established that the expression of FGF5 was increased

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique