Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU114821

Sigma-Aldrich

MISSION® esiRNA

targeting human TERF1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCTTGATGCACAGTTTGAAAATGATGAACGAATTACACCCTTGGAATCAGCCCTGATGATTTGGGGTTCAATTGAAAAGGAACATGACAAACTTCATGAAGAAATACAGAATTTAATTAAAATTCAGGCTATAGCTGTTTGTATGGAAAATGGCAACTTTAAAGAAGCAGAAGAAGTCTTTGAAAGAATATTTGGTGATCCAAATTCTCATATGCCTTTCAAAAGCAAATTGCTTATGATAATCTCTCAGAAAGATACATTTCATTCCTTTTTTCAACACTTCAGCTACAACCACATGATGGAGAAAATTAAGAGTTATGTGAATTATGTGCTAAGTGAAAAATCATCAACCTTTCTAATGAAGGCAGCGGCAAAAGTAGTAGAAAGCAAAAGGACAAGAACAA

Numéro d'accès Ensembl | humain

ENSG00000147601

Numéro d'accès NCBI

NM_003218

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TERF1(7013) , TERF1(7013)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Surya Shin Ichi Sutanto et al.
Journal of cell communication and signaling, 13(4), 523-530 (2019-06-17)
People with diabetes mellitus have shorter telomeres compared with non-diabetic subjects. The aim of this study was to investigate an in-vitro model of telomere shortening under diabetes metabolic conditions. The mechanisms of the accelerated telomere length attrition and the potential
Rosa Maria Porreca et al.
eLife, 9 (2020-01-15)
Telomeres are a significant challenge to DNA replication and are prone to replication stress and telomere fragility. The shelterin component TRF1 facilitates telomere replication but the molecular mechanism remains uncertain. By interrogating the proteomic composition of telomeres, we show that
Luxi Sun et al.
Nucleic acids research, 45(7), 3844-3859 (2017-02-06)
Werner syndrome (WS) is a progeroid-like syndrome caused by WRN gene mutations. WS cells exhibit shorter telomere length compared to normal cells, but it is not fully understood how WRN deficiency leads directly to telomere dysfunction. By generating localized telomere-specific
Lu Yang et al.
Nucleic acids research, 45(7), 3906-3921 (2017-02-06)
Oxidative DNA damage triggers telomere erosion and cellular senescence. However, how repair is initiated at telomeres is largely unknown. Here, we found unlike PARP1-mediated Poly-ADP-Ribosylation (PARylation) at genomic damage sites, PARylation at telomeres is mainly dependent on tankyrase1 (TNKS1). TNKS1

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique