Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU109791

Sigma-Aldrich

MISSION® esiRNA

targeting human RPSA

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTCTCACGGAGGCATCTTATGTTAACCTACCTACCATTGCGCTGTGTAACACAGATTCTCCTCTGCGCTATGTGGACATTGCCATCCCATGCAACAACAAGGGAGCTCACTCAGTGGGTTTGATGTGGTGGATGCTGGCTCGGGAAGTTCTGCGCATGCGTGGCACCATTTCCCGTGAACACCCATGGGAGGTCATGCCTGATCTGTACTTCTACAGAGATCCTGAAGAGATTGAAAAAGAAGAGCAGGCTGCTGCTGAGAAGGCAGTGACCAAGGAGGAATTTCAGGGTGAATGGACTGCTCCCGCTCCTGAGTTCACTGCTACTCAGCCTGAGGTTGCAGACTGGTCTGAAGGTGTACAGGTGCCCTCTGTGCCTATTCAGCAATTCCCTACTGAAGACTGGAGCG

Numéro d'accès Ensembl | humain

ENSG00000168028

Numéro d'accès NCBI

NM_002295

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... RPSA(3921) , RPSA(3921)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Thandokuhle Khumalo et al.
PloS one, 10(10), e0139584-e0139584 (2015-10-02)
Cancer is a global burden due to high incidence and mortality rates and is ranked the second most diagnosed disease amongst non-communicable diseases in South Africa. A high expression level of the 37kDa/67kDa laminin receptor (LRP/LR) is one characteristic of
Kiashanee Moodley et al.
PloS one, 8(3), e57409-e57409 (2013-03-09)
The non-integrin laminin receptor, here designated the 37-kDa/67-kDa laminin receptor (LRP/LR), is involved in many physiologically relevant processes, as well as numerous pathological conditions. The overexpression of LRP/LR on various cancerous cell lines plays critical roles in tumour metastasis and
Guanhong Luo et al.
Oncotarget, 8(42), 71630-71641 (2017-10-27)
Cellular prion protein (PrPC), the infective agent of transmissible spongiform encephalopathies, is thought to be related to several cellular physiological and physiopathological processes. We have previously reported that PrPC participates in multi-drug-resistance of gastric cancer. As the salient ligand molecule
Carryn J Chetty et al.
Experimental cell research, 360(2), 264-272 (2017-09-14)
The 37kDa/67kDa laminin receptor (LRP/LR) serves various physiological and pathological roles such as enhancing tumour-related processes including metastasis, angiogenesis, cellular viability and telomerase activation in cancerous cell lines. The present study investigates the effect of siRNA mediated downregulation of LRP/LR

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique