Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU107751

Sigma-Aldrich

MISSION® esiRNA

targeting human PTTG1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGTCTGGACCTTCAATCAAAGCCTTAGATGGGAGATCTCAAGTTTCAACACCACGTTTTGGCAAAACGTTCGATGCCCCACCAGCCTTACCTAAAGCTACTAGAAAGGCTTTGGGAACTGTCAACAGAGCTACAGAAAAGTCTGTAAAGACCAAGGGACCCCTCAAACAAAAACAGCCAAGCTTTTCTGCCAAAAAGATGACTGAGAAGACTGTTAAAGCAAAAAGCTCTGTTCCTGCCTCAGATGATGCCTATCCAGAAATAGAAAAATTCTTTCCCTTCAATCCTCTAGACTTTGAGAGTTTTGACCTGCCTGAAGAGCACCAGATTGCGCACCTCCCCTTGAGTGGAGTGCCTCTCATGATCCTTGACGAGGAGAGAGAGCTTGAAAAGCTGTTTCAGCTGGGCCCCCCTTCACCTGTGAAGATGCCCTCTCCACCATGGGAATCCAATCTGTTGCAGTCTCCTTCAAGCATTCTGTCGACCCTGGATGTT

Numéro d'accès Ensembl | humain

ENSG00000164611

Numéro d'accès NCBI

NM_004219

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PTTG1(9232) , PTTG1(9232)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lishan Cui et al.
Medical oncology (Northwood, London, England), 37(8), 73-73 (2020-07-30)
Pituitary tumor-transforming gene 1 (PTTG1) has been identified as an oncogene and is overexpressed in many tumor types. However, the role of PTTG1 in glioblastoma (GBM) has not been well characterized, especially in relation to angiogenesis, migration, and invasion. In
Emanuela Teveroni et al.
Cancers, 13(2) (2021-01-13)
(1) Background: PTTG1 sustains the invasiveness of several cancer types. We previously reported that in seminomas, PTTG1 was detected in the peripheral area of the tumor and in the leading infiltrative edge. Here, we investigate the PTTG1 role on the
Litian Yin et al.
Frontiers in pharmacology, 11, 574068-574068 (2020-12-01)
Statins, or 3-hydroxy-3-methylglutaryl-coenzyme A reductase inhibitors, have been widely used to lower cholesterol and prevent cardiovascular diseases. Recent preclinical and clinical studies have shown that statins exert beneficial effects in the management of breast cancer, while the underlying mechanisms remain

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique