Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU106011

Sigma-Aldrich

MISSION® esiRNA

targeting human UQCRB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACTGGGGTTAATGCGAGATGATACAATATACGAGGATGAAGATGTAAAAGAAGCCATAAGAAGACTTCCTGAGAACCTTTATAATGACAGGATGTTTCGCATTAAGAGGGCACTGGACCTGAACTTGAAGCATCAGATCTTGCCTAAAGAGCAGTGGACCAAATATGAAGAGGAAAATTTCTACCTTGAACCGTATCTGAAAGAGGTTATTCGGGAAAGAAAAGAAAGAGAAGAATGGGCAAAGAAGTAATCATGTAGTTGAAGTCTGTGGATGCAGCTGTTATGAAGATGGTTAAACTTGAAACAAACAATTTTAAGAATTATTTGGTCTGAAGATGTTTTACTTTAAATAAATGTCTATTGTAATGGCTGGAGTTTTTGAATTCCAAACCTTATACTGAATAACTACTGAATCCCTTTACTGTTAAATTTTTTTCCAAACTTTCAAGATATATTTAGTTGTGTTTAACTGCTACTTGGAGCTCAGAAGCCACTTTATCAGTTTTCCTCACTGGTTGGATAGCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Frank Cichocki et al.
The Journal of experimental medicine, 215(9), 2379-2395 (2018-08-01)
Natural killer (NK) cells with adaptive immunological properties expand and persist in response to human cytomegalovirus. Here, we explored the metabolic processes unique to these cells. Adaptive CD3-CD56dimCD57+NKG2C+ NK cells exhibited metabolic hallmarks of lymphocyte memory, including increased oxidative mitochondrial
Meng Gao et al.
Journal of cellular physiology, 236(4), 2920-2933 (2020-09-16)
The previous research has shown that mitochondrial flash (mitoflash) genesis are functionally and mechanistically integrated with mitochondrial electron transport chain (ETC) energy metabolism. However, the response of mitoflash to superoxide is not entirely consistent with the response of MitoSOX Red.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique