Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU104541

Sigma-Aldrich

MISSION® esiRNA

targeting human AKR1C3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GATTTGGCACCTATGCACCTCCAGAGGTTCCGAGAAGTAAAGCTTTGGAGGTCACAAAATTAGCAATAGAAGCTGGGTTCCGCCATATAGATTCTGCTCATTTATACAATAATGAGGAGCAGGTTGGACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTCTACACTTCAAAGCTTTGGTCCACTTTTCATCGACCAGAGTTGGTCCGACCAGCCTTGGAAAACTCACTGAAGAAAGCTCAATTGGACTATGTTGACCTCTATCTTATTCATTCTCCAATGTCTCTAAAGCCAGGTGAGGAACTTTCACCAACAGATGAAAATGGAAAAGTAATATTTGACATAGTGGATCTCTGTACCACCTGGGAGGCCATGGAGAAGTGTAAGGATGCAGGATTGGCCAAGTCCATTGGGGTGTCAAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yoshitaka Sekine et al.
Oncology letters, 15(3), 3167-3172 (2018-02-13)
Statins have become of interest in research due to their anticancer effects. However, the exact mechanism of their anticancer properties remains unclear. The authors previously reported that statins decrease intracellular cholesterol levels in androgen-independent prostate cancer cells. In de novo
Melanie M Erzinger et al.
PloS one, 11(3), e0150219-e0150219 (2016-03-08)
The chemoprotective properties of sulforaphane (SF), derived from cruciferous vegetables, are widely acknowledged to arise from its potent induction of xenobiotic-metabolizing and antioxidant enzymes. However, much less is known about the impact of SF on the efficacy of cancer therapy
Chengfei Liu et al.
Molecular cancer therapeutics, 18(10), 1875-1886 (2019-07-17)
The mechanisms resulting in resistance to next-generation antiandrogens in castration-resistant prostate cancer are incompletely understood. Numerous studies have determined that constitutively active androgen receptor (AR) signaling or full-length AR bypass mechanisms may contribute to the resistance. Previous studies established that
Chengfei Liu et al.
Molecular cancer therapeutics, 16(1), 35-44 (2016-10-30)
Abiraterone suppresses intracrine androgen synthesis via inhibition of CYP17A1. However, clinical evidence suggests that androgen synthesis is not fully inhibited by abiraterone and the sustained androgen production may lead to disease relapse. In the present study, we identified AKR1C3, an

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique