Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU094261

Sigma-Aldrich

MISSION® esiRNA

targeting human DUOX1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACAAGGATGGCAATGGCTACCTGTCCTTCCGAGAGTTCCTGGACATCCTGGTGGTCTTCATGAAAGGCTCTCCTGAGGAAAAGTCTCGCCTTATGTTCCGCATGTACGACTTTGATGGGAATGGCCTCATTTCCAAGGATGAGTTCATCAGGATGCTGAGATCCTTCATCGAGATCTCCAACAACTGCCTGTCCAAGGCCCAGCTGGCTGAGGTGGTGGAGTCCATGTTCCGGGAGTCGGGATTCCAGGACAAGGAGGAACTGACATGGGAAGATTTTCACTTCATGCTGCGGGACCACAATAGCGAGCTCCGCTTCACGCAGCTCTGTGTCAAAGGGGTGGAGGTGCCTGAAGTCATCAAGGACCTCTGCCGGCGAGCCTCCTACATCAGCCAGGATATGATCTGTCCCTCTCCCAGAGTG

Numéro d'accès Ensembl | humain

ENSG00000137857

Numéro d'accès NCBI

NM_017434

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... DUOX1(53905) , DUOX1(50506)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sergio Candel et al.
PLoS biology, 12(5), e1001855-e1001855 (2014-05-08)
TNFα overexpression has been associated with several chronic inflammatory diseases, including psoriasis, lichen planus, rheumatoid arthritis, and inflammatory bowel disease. Paradoxically, numerous studies have reported new-onset psoriasis and lichen planus following TNFα antagonist therapy. Here, we show that genetic inhibition
Rabii Ameziane-El-Hassani et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(16), 5051-5056 (2015-04-08)
Ionizing radiation (IR) causes not only acute tissue damage, but also late effects in several cell generations after the initial exposure. The thyroid gland is one of the most sensitive organs to the carcinogenic effects of IR, and we have
Zhimin Feng et al.
Infection and immunity, 82(11), 4458-4465 (2014-08-13)
Currently, Acinetobacter baumannii is recognized as one of the major pathogens seriously threatening our health care delivery system. Aspects of the innate immune response to A. baumannii infection are not yet well understood. Human β-defensins (hBDs) are epithelial cell-derived cationic

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique