Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU090851

Sigma-Aldrich

MISSION® esiRNA

targeting human QKI

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAGTGCAGAATTGCCTGATGCTGTGGGACCTATTGTTCAGTTACAAGAGAAACTTTATGTGCCTGTAAAAGAATACCCAGATTTTAATTTTGTTGGGAGAATCCTTGGACCTAGAGGACTTACAGCCAAACAACTTGAAGCAGAAACCGGATGTAAAATCATGGTCCGAGGCAAAGGCTCAATGAGGGATAAAAAAAAGGAGGAGCAAAATAGAGGCAAGCCCAATTGGGAGCATCTAAATGAAGATTTACATGTACTAATCACTGTGGAAGATGCTCAGAACAGAGCAGAAATCAAATTGAAGAGAGCAGTTGAAGAAGTGAAGAAATTATTGGTACCTGCAGCAGAAGGAGAAGACAGCCTGAAGAAGATGCAGCTGATGGAGCTTGCGATTCTGAA

Numéro d'accès Ensembl | humain

ENSG00000112531

Numéro d'accès NCBI

NM_206855

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... QKI(9444) , QKI(9444)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yunling Wang et al.
PloS one, 5(9) (2010-09-24)
The quaking viable (qk(v)) mouse has several developmental defects that result in rapid tremors in the hind limbs. The qkI gene expresses three major alternatively spliced mRNAs (5, 6 and 7 kb) that encode the QKI-5, QKI-6 and QKI-7 RNA
Feng-Yang Zong et al.
PLoS genetics, 10(4), e1004289-e1004289 (2014-04-12)
Lung cancer is the leading cause of cancer-related death worldwide. Aberrant splicing has been implicated in lung tumorigenesis. However, the functional links between splicing regulation and lung cancer are not well understood. Here we identify the RNA-binding protein QKI as
Salma H Azam et al.
Oncogene, 38(26), 5191-5210 (2019-03-29)
Angiogenesis is critical to cancer development and metastasis. However, anti-angiogenic agents have only had modest therapeutic success, partly due to an incomplete understanding of tumor endothelial cell (EC) biology. We previously reported that the microRNA (miR)-200 family inhibits metastasis through
Yan Sun et al.
Cell death & disease, 11(6), 432-432 (2020-06-10)
Vascular remodeling can be caused by angiotensin II type 1 receptor (AT1R) autoantibody (AT1-AA), although the related mechanism remains unknown. Angiotensin II type 2 receptor (AT2R) plays multiple roles in vascular remodeling through cross-talk with AT1R in the cytoplasm. Here

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique