Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU088861

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGA6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCCTCTTCATTTGGCTATGATGTGGCGGTGGTGGACCTCAACAAGGATGGGTGGCAAGATATAGTTATTGGAGCCCCACAGTATTTTGATAGAGATGGAGAAGTTGGAGGTGCAGTGTATGTCTACATGAACCAGCAAGGCAGATGGAATAATGTGAAGCCAATTCGTCTTAATGGAACCAAAGATTCTATGTTTGGCATTGCAGTAAAAAATATTGGAGATATTAATCAAGATGGCTACCCAGATATTGCAGTTGGAGCTCCGTATGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAAATACCAAACCAACACAGGTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTGGAAACATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCT

Numéro d'accès Ensembl | humain

ENSG00000091409

Numéro d'accès NCBI

NM_000210

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ITGA6(3655) , ITGA6(3655)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Miyeon Kim et al.
Stem cells international, 2020, 5924983-5924983 (2020-05-14)
Mesenchymal stem cells (MSCs) represent a promising means to promote tissue regeneration. However, the heterogeneity of MSCs impedes their use for regenerative medicine. Further investigation of this phenotype is required to develop cell therapies with improved clinical efficacy. Here, a
Chunbo He et al.
Cell reports, 26(10), 2636-2650 (2019-03-07)
HPV infections are common in healthy women and only rarely cause cervical cancer, suggesting that individual genetic susceptibility may play a critical role in the establishment of persistent HPV infection and the development of cervical cancer. Here, we provide convincing in vitro
Daiane Cristina F Golbert et al.
Cell adhesion & migration, 12(2), 152-167 (2017-05-12)
The thymus supports differentiation of T cell precursors. This process requires relocation of developing thymocytes throughout multiple microenvironments of the organ, mainly with thymic epithelial cells (TEC), which control intrathymic T cell differentiation influencing the formation and maintenance of the
Nan Liu et al.
Nature, 568(7752), 344-350 (2019-04-05)
Stem cells underlie tissue homeostasis, but their dynamics during ageing-and the relevance of these dynamics to organ ageing-remain unknown. Here we report that the expression of the hemidesmosome component collagen XVII (COL17A1) by epidermal stem cells fluctuates physiologically through genomic/oxidative
Dan Vershkov et al.
Cell reports, 26(10), 2531-2539 (2019-03-07)
Fragile X syndrome (FXS) is caused primarily by a CGG repeat expansion in the FMR1 gene that triggers its transcriptional silencing. In order to investigate the regulatory layers involved in FMR1 inactivation, we tested a collection of chromatin modulators for

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique