Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU088751

Sigma-Aldrich

MISSION® esiRNA

targeting human JMJD1C

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGCAAGGTCCTTATTCCTTAAATGGATACAGAGTGAGAGTATATAGACAAGACTCTGCCACCCAGTGGTTTACTGGCATAATTACTCATCATGATCTCTTCACCCGCACCATGATCGTTATGAATGATCAGGTACTAGAACCACAGAATGTCGATCCTTCTATGGTTCAAATGACCTTTCTAGATGATGTTGTTCACTCTTTGTTAAAAGGTGAAAATATTGGCATTACATCACGACGCAGGTCTCGTGCCAATCAAAACGTCAACGCTGTTCACAGCCATTATACACGTGCCCAAGCAAATAGTCCCAGACCAGCAATGAACTCCCAAGCTGCTGTACCAAAACAGAATACACACCAGCAACAGCAACAAAGAAGTATCCGTCCAAATAAGAGGAAGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Cheng Chen et al.
American journal of cancer research, 8(5), 852-865 (2018-06-12)
Colorectal cancer (CRC) is one of the most common malignant gastrointestinal cancers. Metastasis is a major leading of death in patients with CRC and many patients have metastatic disease at diagnosis. However, the underlying molecular mechanisms are still elusive. Here
Mir Ali et al.
BMC developmental biology, 21(1), 6-6 (2021-02-04)
Cardiomyocytes proliferate rapidly during fetal life but lose their ability of proliferation soon after birth. However, before terminal withdrawal from the cell cycle, cardiomyocytes undergo another round of cell cycle during early postnatal life in mice. While a transient wave

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique