Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU085701

Sigma-Aldrich

MISSION® esiRNA

targeting human APP

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTCGTTCCTGACAAGTGCAAATTCTTACACCAGGAGAGGATGGATGTTTGCGAAACTCATCTTCACTGGCACACCGTCGCCAAAGAGACATGCAGTGAGAAGAGTACCAACTTGCATGACTACGGCATGTTGCTGCCCTGCGGAATTGACAAGTTCCGAGGGGTAGAGTTTGTGTGTTGCCCACTGGCTGAAGAAAGTGACAATGTGGATTCTGCTGATGCGGAGGAGGATGACTCGGATGTCTGGTGGGGCGGAGCAGACACAGACTATGCAGATGGGAGTGAAGACAAAGTAGTAGAAGTAGCAGAGGAGGAAGAAGTGGCTGAGGTGGAAGAAGAAGAAGCCGATGATGACGAGGACGATGAGGATGGTGATGAGGTAGAGGAAGAGGCTGAGGAACCCTACGAAGAAGCCACAGAGAGAACCACCAGCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... APP(351) , APP(351)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bruce X Wong et al.
PloS one, 9(12), e114174-e114174 (2014-12-03)
Ceruloplasmin is a ferroxidase that interacts with ferroportin to export cellular iron, but is not expressed in neurons. We recently reported that the amyloid precursor protein (APP) is the analogous iron-exporting chaperone for neurons and other cells. The ferroxidase activity
Changyi Ji et al.
Cellular and molecular neurobiology, 38(4), 941-954 (2017-11-28)
Iron efflux in mammalian cells is mediated by the ferrous iron exporter ferroportin (Fpn); Fpn plasma membrane localization and function are supported by a multicopper ferroxidase and/or the soluble amyloid precursor protein (sAPP). Fpn and APP are ubiquitously expressed in
Nathalie Pierrot et al.
EMBO molecular medicine, 5(4), 608-625 (2013-04-05)
Perturbation of lipid metabolism favours progression of Alzheimer disease, in which processing of Amyloid Precursor Protein (APP) has important implications. APP cleavage is tightly regulated by cholesterol and APP fragments regulate lipid homeostasis. Here, we investigated whether up or down
Livius V d'Uscio et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 38(10), 1715-1726 (2017-09-30)
The exact physiological function of amyloid-β precursor protein (APP) in endothelial cells is unknown. Endothelium-specific APP-deficient (eAPP-/-) mice were created to gain new insights into the role of APP in the control of vascular endothelial function. Endothelium-dependent relaxations to acetylcholine
Philipp Spitzer et al.
Frontiers in immunology, 11, 1967-1967 (2020-10-06)
It has been previously shown that the amyloid precursor protein (APP) support the innate immune defense as an immune receptor. Amyloid β (Aβ) peptides seem to have properties of an antimicrobial peptide and can act as opsonines. In APP-deficient mouse

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique