Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU081661

Sigma-Aldrich

MISSION® esiRNA

targeting human NTRK1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCCTGCCTCTTCCTTTCTACGCTGCTCCTTGTGCTCAACAAATGTGGACGGAGAAACAAGTTTGGGATCAACCGCCCGGCTGTGCTGGCTCCAGAGGATGGGCTGGCCATGTCCCTGCATTTCATGACATTGGGTGGCAGCTCCCTGTCCCCCACCGAGGGCAAAGGCTCTGGGCTCCAAGGCCACATCATCGAGAACCCACAATACTTCAGTGATGCCTGTGTTCACCACATCAAGCGCCGGGACATCGTGCTCAAGTGGGAGCTGGGGGAGGGCGCCTTTGGGAAGGTCTTCCTTGCTGAGTGCCACAACCTCCTGCCTGAGCAGGACAAGATGCTGGTGGCTGTCAAGGCACTGAAGGAGGCGTCCGAGAGTGCTCGGCAGGACTTCCAGCGTGAGGCTG

Numéro d'accès Ensembl | humain

ENSG00000198400

Numéro d'accès NCBI

NM_001012331

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NTRK1(4914) , NTRK1(4914)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
CAV
JUU
QCS
NRR
RPR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Marzia Di Donato et al.
Cancers, 11(6) (2019-06-09)
Resistance to hormone therapy and disease progression is the major challenge in clinical management of prostate cancer (PC). Drugs currently used in PC therapy initially show a potent antitumor effects, but PC gradually develops resistance, relapses and spreads. Most patients
Sam Faulkner et al.
The American journal of pathology, 188(1), 229-241 (2017-10-19)
Neurotrophin receptors are emerging targets in oncology, but their clinicopathologic significance in thyroid cancer is unclear. In this study, the neurotrophin tyrosine receptor kinase TrkA (also called NTRK1), the common neurotrophin receptor p75NTR, and the proneurotrophin receptor sortilin were analyzed
Xinyuan Yang et al.
Oncogene, 38(15), 2778-2787 (2018-12-14)
Multiple cancer signalling networks take part in regulatory crosstalks with the Hippo tumour suppressor pathway through the transcriptional cofactor Yes-associated protein (YAP). Nevertheless, how YAP is controlled by pathway crosstalks in tumourigenesis remains poorly understood. Here, we performed a targeted
Wenyu Shi et al.
Molecular oncology, 11(9), 1189-1207 (2017-05-31)
Nucleophosmin-anaplastic lymphoma kinase-expressing (NPM-ALK+ ) T-cell lymphoma is an aggressive neoplasm that is more commonly seen in children and young adults. The pathogenesis of NPM-ALK+ T-cell lymphoma is not completely understood. Wild-type ALK is a receptor tyrosine kinase that is
M Rochman et al.
Mucosal immunology, 8(4), 785-798 (2014-11-13)
Although interleukin (IL)-13 and neurotrophins are functionally important for the pathogenesis of immune responses, the interaction of these pathways has not been explored. Herein, by interrogating IL-13-induced responses in human epithelial cells we show that neurotrophic tyrosine kinase receptor, type

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique