Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU079871

Sigma-Aldrich

MISSION® esiRNA

targeting human TEAD1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTTTATTTCTAGTGACCCAATATGCATATTAACCTGCTATAACTAGGGCTATATGTGTAGGTATGTGTATACATATACACAAATGCACATATAGAGTTAACACATTTAGTGAACACTTGTTTAGTGTCACTCAGTTTGCTAGGTGCTGATATGTACGTATATCTCAATGTGTCTGTAGACTTAGATACATCCTCTTGAAGCACATCCATTTCTTTAGCGTCTCTCAGTAAGTTACAGTACTTGTTTGACTTAGGTTTAAGAGGCCCAGCTACCTATCTCTGACCTTTTCAAATAGGCTCATTTGGGAGATTCTTTTGCCAGGAGAGATTCAACTTTCCAATCTAAGTATTCCAGAGCATTGCCCAGGCAGAGTTGGTTTGATGTGGCCAGATGTTTTGAGTTATTTCCCTTAAGTGTTTCACTGGGGAGAGAACAGGGAG

Numéro d'accès Ensembl | humain

ENSG00000187079

Numéro d'accès NCBI

NM_021961

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TEAD1(7003) , TEAD1(7003)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Min-Hao Yu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 496-501 (2016-10-25)
Colorectal cancer (CRC) is the most common type of gastrointestinal cancer. However, up to date, the specific mechanism for CRC proliferation remains unclear. Transcriptional enhancer activator domain 1 (TEAD1) is a transcription factor belongs to the TEAD family, which plays
Shi Jiao et al.
Nature communications, 8, 14058-14058 (2017-01-05)
Concerted co-regulation of multiple signalling pathways is crucial for tissue homoeostasis and tumorigenesis. Here we report that VGLL4, a previously identified YAP antagonist, also functions as a regulator of Wnt/β-catenin signalling. The expression of VGLL4 is significantly downregulated in clinical
Claudia Stein et al.
PLoS genetics, 11(8), e1005465-e1005465 (2015-08-22)
YAP1 is a major effector of the Hippo pathway and a well-established oncogene. Elevated YAP1 activity due to mutations in Hippo pathway components or YAP1 amplification is observed in several types of human cancers. Here we investigated its genomic binding

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique