Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU077641

Sigma-Aldrich

MISSION® esiRNA

targeting human NOVA1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AATGTGGCCAAGACAGAACCAGTCAGCATTCTACAACCCCAGACCACCGTTAATCCAGATCGCATCAAACAAACATTGCCATCTTCCCCAACTACCACCAAGTCCTCTCCATCTGATCCCATGACCACCTCCAGAGCTAATCAGGTAAAGATTATAGTTCCCAACAGCACAGCAGGTCTGATAATAGGGAAGGGAGGTGCTACTGTGAAGGCTGTAATGGAGCAGTCAGGGGCTTGGGTGCAGCTTTCCCAGAAACCTGATGGGATCAACTTGCAAGAGAGGGTTGTCACTGTGAGTGGAGAACCTGAACAAAACCGAAAAGCTGTTGAACTTATCATCCAGAAGATACAAGAGGATCCACAAAGTGGCAGCTGTCTCAATATCAGTTATGCCAATGTGACAGGTCCAGTGGCAAATTCCAATCCAACCGGATCTCCTTATG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xin Yu et al.
Journal of cellular and molecular medicine, 22(5), 2622-2630 (2018-03-03)
Increasing studies have suggested that dysregulation of RNA-binding proteins (RBPs) contributes to cancer progression. Neuro-oncological ventral antigen 1 (NOVA1) is a novel RBP and plays an important role in tumour development. However, the expression and role of NOVA1 in melanoma
Feng Zhi et al.
PloS one, 9(10), e109124-e109124 (2014-10-10)
MicroRNAs (miRNAs) are small, short noncoding RNAs that modulate the expression of numerous genes by targeting their mRNA. Numerous abnormal miRNA expression patterns are observed in various human malignancies, and certain miRNAs can act as oncogenes or tumor suppressors. Astrocytoma

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique