Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU077201

Sigma-Aldrich

MISSION® esiRNA

targeting human OPTN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGGCTCCTCAGAAGATTCCTTTGTTGAAATTAGGATGGCTGAAGGAGAAGCAGAAGGGTCAGTAAAAGAAATCAAGCATAGTCCTGGGCCCACGAGAACAGTCTCCACTGGCACGGCATTGTCTAAATATAGGAGCAGATCTGCAGATGGGGCCAAGAATTACTTCGAACATGAGGAGTTAACTGTGAGCCAGCTCCTGCTGTGCCTAAGGGAAGGGAATCAGAAGGTGGAGAGACTTGAAGTTGCACTCAAGGAGGCCAAAGAAAGAGTTTCAGATTTTGAAAAGAAAACAAGTAATCGTTCTGAGATTGAAACCCAGACAGAGGGGAGCACAGAGAAAGAGAATGATGAAGAGAAAGGCCCGGAGACTGTTGGAAGCGAAGTGGAAGCACTGAACCTCCAGGTG

Numéro d'accès Ensembl | humain

ENSG00000123240

Numéro d'accès NCBI

NM_021980

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... OPTN(10133) , OPTN(10133)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
DHU
WNS
ZDS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kehong Chen et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(3), 4571-4585 (2018-12-21)
Tubulointerstitial inflammation plays a critical role in the progression of diabetic nephropathy (DN), and nucleotide-binding oligomerization domain-like receptor family pyrin domain-containing 3 (NLRP3) inflammasomes contribute to renal interstitial inflammation in DN. Decreased expression of optineurin (OPTN) is also associated with
Astrid Skjesol et al.
PLoS pathogens, 15(3), e1007684-e1007684 (2019-03-19)
Phagocytosis is a complex process that eliminates microbes and is performed by specialised cells such as macrophages. Toll-like receptor 4 (TLR4) is expressed on the surface of macrophages and recognizes Gram-negative bacteria. Moreover, TLR4 has been suggested to play a
Vinod Sundaramoorthy et al.
Human molecular genetics, 24(13), 3830-3846 (2015-04-11)
Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder primarily affecting motor neurons. Mutations in optineurin cause a small proportion of familial ALS cases, and wild-type (WT) optineurin is misfolded and forms inclusions in sporadic ALS patient motor neurons. However

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique