Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU075831

Sigma-Aldrich

MISSION® esiRNA

targeting human PRODH

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAGGAAAGTGTCGCAAAGTTGGGCATCGCATCCAGGGCTGAGATTGAGGACTGGTTCACGGCAGAGACCCTGGGAGTGTCTGGCACCATGGACCTGCTGGACTGGAGCAGCCTCATCGACAGCAGGACCAAGCTGTCCAAGCACTTGGTAGTCCCCAACGCACAGACAGGACAGCTGGAGCCCCTGCTGTCCCGGTTCACTGAGGAGGAGGAGCTACAGATGACCAGGATGCTACAGCGGATGGATGTCCTGGCCAAGTTGCTCCCACTCTCCCACCCCCTGCGCCTCTCAGAAAGCCACAGAGATGGGCGTGCGGCTGATGGTGGATGCCGAGCAGACCTACTTCCAGCCGGCCATCAGCCGCCTGACGCTGGAGATGCAGCGGAAGTTCAATGTGGAGAAGCCG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Huiying Li et al.
Toxins, 11(4) (2019-04-19)
The toxicity and related mechanisms of aflatoxin B1 (AFB1) and aflatoxin M1 (AFM1) in the mouse kidney were studied, and the role of l-proline in alleviating kidney damage was investigated. In a 28-day toxicity mouse model, thirty mice were divided
Ilona Zareba et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(2), 670-684 (2017-09-25)
The effect of impaired intracellular proline availability for proline dehydrogenase/proline oxidase (PRODH/POX)-dependent apoptosis was studied. We generated a constitutively knocked-down PRODH/POX MCF-7 breast cancer cell line (MCF-7shPRODH/POX) as a model to analyze the functional consequences of impaired intracellular proline levels.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique