Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU073331

Sigma-Aldrich

MISSION® esiRNA

targeting human DNM3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGACAGGAATCTCCTCAGAATGAAGAATAAAGCCTACTAGGTCTCTAACTGTTGAACTCATGAAAGAAGATAGTGTATGAGACTTAAGCCATGAGTTTTGTATCATTTCAATTAGAAGACTACTAGCTGTGAGCTCAGAGTTTAATGTAAATGAATCTAGATGATTTTGAAGAAATGATTATTCGTTCACCAGATCACTCATTGTACATTCTAAAAAGCTCAAATGAGTCTTCTAGATACTCTTACTCATCCTGTCTGGTTGCTATGTTTAAAATTATGTGGTGCTGTGTAGGTGAAACTTTAAGAATATTTTTGAAGCATATGTAATATATGCACTGCTATTTGTGTGTGTGTGTGTGTCTTTGTATATATGTAAGAATGTGTGTATGTGTGAGAGCAAGAGAGAGGA

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bin Sheng Wong et al.
Cancer research, 79(11), 2878-2891 (2019-04-13)
The sialoglycoprotein podocalyxin is absent in normal pancreas but is overexpressed in pancreatic cancer and is associated with poor clinical outcome. Here, we investigate the role of podocalyxin in migration and metastasis of pancreatic adenocarcinomas using SW1990 and Pa03c as
Chao Gu et al.
Oncology letters, 13(6), 4776-4784 (2017-06-11)
Dynamin 3 (DNM3) is candidate tumor suppressor against hepatocellular carcinoma (HCC). Downregulation of DNM3 is more frequently identified in HCC tissues than in normal liver tissues. However, the mechanism underlying DNM3-mediated inhibition of HCC remains unclear. The present study demonstrated

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique