Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU073311

Sigma-Aldrich

MISSION® esiRNA

targeting human ARHGAP24

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TACACACGGTGGCATCACTTCTTAAGCTGTACCTCCGAGAACTTCCAGAACCAGTTATTCCTTATGCGAAGTATGAAGATTTTTTGTCATGTGCCAAACTGCTCAGCAAGGAAGAGGAAGCAGGTGTTAAGGAATTAGCAAAGCAGGTGAAGAGTTTGCCAGTGGTAAATTACAACCTCCTCAAGTATATTTGCAGATTCTTGGATGAAGTACAGTCCTACTCGGGAGTTAACAAAATGAGTGTGCAGAACTTGGCAACGGTCTTTGGTCCTAATATCCTGCGCCCCAAAGTGGAAGATCCTTTGACTATCATGGAGGGCACTGTGGTGGTCCAGCAGTTGATGTCAGTGATGATTAGCAAACATGATTGCCTCTTTCCCAAAGATGCAGAACTACAAAGCAAGCCCCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Eva Tonsing-Carter et al.
Molecular cancer therapeutics, 14(12), 2850-2863 (2015-10-24)
Triple-negative breast cancers (TNBC) are typically resistant to treatment, and strategies that build upon frontline therapy are needed. Targeting the murine double minute 2 (Mdm2) protein is an attractive approach, as Mdm2 levels are elevated in many therapy-refractive breast cancers.
Flaviana Marzano et al.
Molecular biology of the cell, 26(15), 2733-2741 (2015-06-13)
The regulation of insulin-like growth factor-binding protein 3 (IGFBP3) gene expression is complex, because it can be induced by agents that both stimulate and inhibit the proliferation. The principal aim of this study was to investigate whether p73, a member

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique