Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU068841

Sigma-Aldrich

MISSION® esiRNA

targeting human AMFR

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCCTTTCTGTCCCACTACATCTGGGACTGACTTTCCGAGCCTCCAGTCCAAAGCCGGCTTGATTTCCGTGAACTCTGGTGCTCCTGCATCTCATGAGTGTGCCCCATGGGTCCCCTCCCCTCTCAGCATTTCCTTGTCCCGTCTGGACCTGGGGAGTGGTTAGGCAGCAAGCTTTGGTTTATGGTTTTCATTCATTGGTGAAGTAAATTAGGCAGTGCTAAAGCCTGTGGGTTTGGTCCTTGAACAAGATGTGGGCCTTGCAAGATGGGAGAGTAAACCTTGAAGGGCTTTATTAAAGAAATAAAAAAGAACTTTTGTATCTTTTATCCTGGGAGCACTGCGTTTTCCTAGCTGTGTTATTCCTGGTTTAATTCAGCAGAGAAGGTAAGGTGTGAACCTACCTGCCTTGGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Youngah Jo et al.
Molecular biology of the cell, 24(3), 169-183 (2012-12-12)
Sterol-induced binding to Insigs in endoplasmic reticulum (ER) membranes triggers ubiquitination of the cholesterol biosynthetic enzyme 3-hydroxy-3-methylglutaryl CoA reductase. This ubiquitination, which is mediated by Insig-associated ubiquitin ligases gp78 and Trc8, is obligatory for extraction of reductase from lipid droplet-associated
Jin Chai et al.
Journal of hepatology, 63(6), 1440-1448 (2015-07-28)
Multidrug resistance-associated protein 2 (MRP2) excretes conjugated organic anions including bilirubin and bile acids. Malfunction of MRP2 leads to jaundice in patients. Studies in rodents indicate that Radixin plays a critical role in determining Mrp2 canalicular membrane expression. However, it
Kerrie L Marie et al.
Nature communications, 11(1), 333-333 (2020-01-18)
Cutaneous malignant melanoma is an aggressive cancer of melanocytes with a strong propensity to metastasize. We posit that melanoma cells acquire metastatic capability by adopting an embryonic-like phenotype, and that a lineage approach would uncover metastatic melanoma biology. Using a
Ming Zong et al.
Arthritis research & therapy, 17, 100-100 (2015-04-19)
Fibroblast-like synoviocytes (FLS) play an important role in the pathogenesis of rheumatoid arthritis (RA). This study aimed to investigate the role of glucose 6-phosphate isomerase (GPI) in the proliferation of RA-FLS. The distribution of GPI in synovial tissues from RA

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique