Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU065551

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP11C

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGAAAGAGCGAGAGACCTTGAAGGTTTTAAAAATGTTCACCGACTTCCTATCATTTATGGTTCTATTCAACTTTATCATTCCTGTCTCCATGTACGTCACAGTAGAAATGCAGAAATTCTTGGGCTCCTTCTTCATCTCATGGGATAAGGACTTTTATGATGAAGAAATTAATGAAGGAGCCCTGGTTAACACATCAGACCTTAATGAAGAACTTGGTCAGGTGGATTATGTATTTACAGATAAGACTGGAACACTCACTGAAAACAGCATGGAATTCATTGAATGCTGCATAGATGGCCACAAATATAAAGGTGTAACTCAAGAGGTTGATGGATTATCTCAAACTGATGGAACTTTAACATATTTTGACAAAGTAGATAAGAATCGAGAAGAGCTGTTTCTACGTGCCTTGTGTTTATGTCATACTGTAGAAATCAAAACAAACGATGCTGTTGATGGAGCTA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Donatien Kamdem Toukam et al.
PloS one, 7(5), e38068-e38068 (2012-06-06)
Although human immunodeficiency type 1 (HIV-1) infection induces strong antibody responses to the viral envelope glycoprotein (Env) only a few of these antibodies possess the capacity to neutralize a broad range of strains. The induction of such antibodies represents an
Theo Rispens et al.
PloS one, 8(2), e55566-e55566 (2013-02-08)
IgE antibodies to gal-α-1,3-gal-β-1,4-GlcNAc (α-gal) can mediate a novel form of delayed anaphylaxis to red meat. Although IgG antibodies to α-gal (anti-α-gal or anti-Gal) are widely expressed in humans, IgE anti-α-gal is not. We explored the relationship between the IgG
Alessandra Ghiani et al.
PloS one, 11(5), e0155803-e0155803 (2016-05-18)
Tomato (Solanum lycopersicum) is one of the most extensively consumed vegetables but, unfortunately, it is also able to induce allergic reactions. In the past, it has been shown that the choice of tomato cultivar significantly influenced the allergic reaction of
Li-Te Chin et al.
BMC biotechnology, 7, 51-51 (2007-08-24)
The ability to acquire fully human monoclonal antibodies (mAbs) with pre-defined specificities is critical to the development of molecular tags for the analysis of receptor function in addition to promising immunotherapeutics. Yet most of the arriving affinity maturated and complete
Pallara Janardhanan Wills et al.
PloS one, 11(4), e0152787-e0152787 (2016-04-14)
Lepidopterism is a disease caused by the urticating scales and toxic fluids of adult moths, butterflies or its caterpillars. The resulting cutaneous eruptions and systemic problems progress to clinical complications sometimes leading to death. High incidence of fever epidemics were

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique