Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU063661

Sigma-Aldrich

MISSION® esiRNA

targeting human METTL3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGCCAGCCAAGAAATCAAGGAAACATGCTGCCTCAGATGTTGATCTGGAGATAGAGAGCCTTCTGAACCAACAGTCCACTAAGGAACAACAGAGCAAGAAGGTCAGTCAGGAGATCCTAGAGCTATTAAATACTACAACAGCCAAGGAACAATCCATTGTTGAAAAATTTCGCTCTCGAGGTCGGGCCCAAGTGCAAGAATTCTGTGACTATGGAACCAAGGAGGAGTGCATGAAAGCCAGTGATGCTGATCGACCCTGTCGCAAGCTGCACTTCAGACGAATTATCAATAAACACACTGATGAGTCTTTAGGTGACTGCTCTTTCCTTAATACATGTTTCCACATGGATACCTGCAAGTATGTTCACTATGAAATTGATGCTTGCATGGATTCTGAGGCCCCTGGCAGCAAAGACCACACGCCAAGCCAGGAGCTTGCTCTTACACAGAGTGTCGGAGGTGATTCCAGT

Numéro d'accès Ensembl | humain

ENSG00000165819

Numéro d'accès NCBI

NM_019852

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... METTL3(56339) , METTL3(56339)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Classe de danger pour l'eau (WGK)

WGK 1

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shiyan Gu et al.
Toxicology letters, 292, 1-11 (2018-04-24)
N6-methyladenosine (m6A) modification is implicated to play an important role in cellular biological processes, but its regulatory mechanisms in arsenite-induced carcinogenesis are largely unknown. Here, human bronchial epithelial (HBE) cells were chronically treated with 2.5 μM arsenite sodium (NaAsO2) for about
Ye Lin et al.
Cancer medicine, 9(8), 2859-2867 (2020-02-19)
METTL3 is an RNA methyltransferase implicated in the control of cell differentiation and proliferation in embryonic development and cancer. The current study was aimed to explore the function and underlying mechanism of METTL3 in hepatocellular carcinoma (HCC). We evaluated the
Hongbing Wu et al.
Genes and immunity, 21(3), 193-202 (2020-05-28)
Maturation of dendritic cells (DCs) initiates adaptive immune responses and thereby provokes allograft rejection. Here, this study aimed to explore the effect of Methyltransferase-like protein 3 (METTL3) silencing on DC function and the role of METTL3-silencing donor DCs in the
Chunxia Zhang et al.
Nature, 549(7671), 273-276 (2017-09-05)
N
Nian Liu et al.
Nucleic acids research, 45(10), 6051-6063 (2017-03-24)
N6-methyladenosine (m6A) is the most abundant internal modification in eukaryotic messenger RNA (mRNA), and affects almost every stage of the mRNA life cycle. The YTH-domain proteins can specifically recognize m6A modification to control mRNA maturation, translation and decay. m6A can
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique