Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU061351

Sigma-Aldrich

MISSION® esiRNA

targeting human NEDD4L

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTCTGCCACGGACAACTACACCCTTCAGATCAACCCTAATTCAGGCCTCTGTAATGAGGATCATTTGTCCTACTTCACTTTTATTGGAAGAGTTGCTGGTCTGGCCGTATTTCATGGGAAGCTCTTAGATGGTTTCTTCATTAGACCATTTTACAAGATGATGTTGGGAAAGCAGATAACCCTGAATGACATGGAATCTGTGGATAGTGAATATTACAACTCTTTGAAATGGATCCTGGAGAATGACCCTACTGAGCTGGACCTCATGTTCTGCATAGACGAAGAAAACTTTGGACAGACATATCAAGTGGATTTGAAGCCCAATGGGTCAGAAATAATGGTCACAAATGAAAACAAAAGGGAATATATCGACTTAGTCATCCAGTGGAGATTTGTGAACAGGGTCCAGAAGCAGATG

Numéro d'accès Ensembl | humain

ENSG00000049759

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NEDD4L(23327) , NEDD4L(23327)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kimberly Gomez et al.
Molecular brain, 14(1), 20-20 (2021-01-23)
Voltage-gated sodium channels are key players in neuronal excitability and pain signaling. Functional expression of the voltage-gated sodium channel NaV1.7 is under the control of SUMOylated collapsin response mediator protein 2 (CRMP2). When not SUMOylated, CRMP2 forms a complex with
Jonathan R Hughes et al.
Frontiers in cell and developmental biology, 8, 607060-607060 (2020-12-08)
8-Oxoguanine DNA glycosylase (OGG1) is the major cellular enzyme required for the excision of 8-oxoguanine DNA base lesions in DNA through the base excision repair (BER) pathway, and therefore plays a major role in suppressing mutagenesis and in controlling genome
Yuan Wang et al.
Biochemical and biophysical research communications, 531(4), 581-587 (2020-08-20)
The ubiquitin-proteasome system (UPS) is composed of E1 ubiquitin-activating enzyme, E2 ubiquitin-conjugating enzyme, and E3 ubiquitin ligase, which play a fundamental role in mediating intracellular protein degradation. Ferroptosis is a non-apoptotic regulated cell death caused by iron accumulation and subsequent
Neil J Grimsey et al.
Cell reports, 24(12), 3312-3323 (2018-09-21)
Ubiquitination is essential for protein degradation and signaling and pivotal to many physiological processes. Ubiquitination of a subset of G-protein-coupled receptors (GPCRs) by the E3 ligase NEDD4-2 is required for p38 activation, but how GPCRs activate NEDD4-2 to promote ubiquitin-mediated
Dong-Eun Lee et al.
Cell death & disease, 11(1), 38-38 (2020-01-22)
In mammals, autophagosome formation is initiated by ULK1 via the posttranslational modification of this protein. However, the precise role of ULK1 ubiquitination in modulating autophagy is unknown. Here, we show that NEDD4L, an E3 ubiquitin ligase, binds ULK1 in pancreatic
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique