Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU060831

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCGTCAAGCCTCTGACAACTATTGAATTTGTAAGCTGCTATGCAAATGGGCATTTATATAAACTTGTGATGTTTCTTGTCAGAATTCTGAGTACTCTGTGAAGAACAGAAATGATCATATTCTTATGCATCTATCTGTATGGGTCTGAAGGTGTATATACAAACTGAGATGAGTCCTTATGACTCTTGATAAGCCTGAGTTTAACAACAACAAAAATGCCAAGTTGTCCTGAGCCCTTCTGCGTTGTTATGCCACTTCCCTACTGCTCATATGCACGCTGGCTCCCCTGGGCACGCAAGGATGAGTATGGGCCATGGGCCCCTGTAGAGCTGCTTACCTGGTGATGACCATGCACCTTACAATTTCTGAACAGTTAACCCTATAGAAGCATGCTTTATATGAGTGTCTTCTGGGAAGAGGAACCTTCTTAATCTCTTCTGTGGGATTTTCAAAATGCTAAAGACTCACACTGCAGCAATCATCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Florian Willecke et al.
Journal of vascular research, 56(6), 308-319 (2019-08-23)
Tumor necrosis factor (TNF) receptor-associated factors (TRAFs) are cytoplasmic adaptor proteins of the TNF/interleukin (IL)-1/Toll-like receptor superfamily. Ligands of this family such as TNFα, CD40L, and IL-1β promote chronic inflammatory processes such as atherosclerosis and restenosis, the latter being a
Jun Shen et al.
International journal of medical sciences, 10(2), 156-163 (2013-01-19)
TRAF3 and TRAF5 share a common ancestral gene, and interact as essential components of signaling pathways in immunity. TRAF3 and TRAF5 are overexpressed in the colon of rat/mouse models with colitis. However, the expressions of TRAF3 and TRAF5 in patients

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique