Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU055781

Sigma-Aldrich

MISSION® esiRNA

targeting human LATS2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGTGCCTTGCTTGTAAGGTGGACACTCACGCCCTGTACGCCATGAAGACCCTAAGGAAAAAGGATGTCCTGAACCGGAATCAGGTGGCCCACGTCAAGGCCGAGAGGGACATCCTGGCCGAGGCAGACAATGAGTGGGTGGTCAAACTCTACTACTCCTTCCAAGACAAAGACAGCCTGTACTTTGTGATGGACTACATCCCTGGTGGGGACATGATGAGCCTGCTGATCCGGATGGAGGTCTTCCCTGAGCACCTGGCCCGGTTCTACATCGCAGAGCTGACTTTGGCCATTGAGAGTGTCCACAAGATGGGCTTCATCCACCGAGACATCAAGCCTGATAACATTTTGATAGATCTGGATGGTCACATTAAACTCACAGATTTCGGCCTCTGCACTGGGTTCAGGTGGACTCACAATTCCAAATATTACCAGAAAGGGAGCCATG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ke Wang et al.
International journal of molecular medicine, 47(4) (2021-02-13)
Long non‑coding RNAs (lncRNAs) are a class of non‑protein coding transcripts that are involved in the regulation of gene expression in mammalian cells. Transcriptional co‑activator Yes associated protein 1 (YAP1) plays a key role in the progression of ovarian cancer.
Cédric Belair et al.
Silence, 2(1), 7-7 (2011-10-27)
MicroRNAs, post-transcriptional regulators of eukaryotic gene expression, are implicated in host defense against pathogens. Viruses and bacteria have evolved strategies that suppress microRNA functions, resulting in a sustainable infection. In this work we report that Helicobacter pylori, a human stomach-colonizing
Cong Dong et al.
Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology, 44(6), 475-481 (2015-03-19)
Many reports indicated LATS2 was a component of the Hippo pathway, could phosphorylate and inactivate YAP, acted as a tumor suppressor in human cancers. But few studies investigated the role of LATS2 in oral squamous cell carcinoma (OSCC) and clarified
Tone B Enger et al.
Laboratory investigation; a journal of technical methods and pathology, 93(11), 1203-1218 (2013-10-02)
Sjogren's syndrome (SS) is a complex autoimmune disease that primarily affects salivary and lacrimal glands and is associated with high morbidity. Although the prevailing dogma is that immune system pathology drives SS, increasing evidence points to structural defects, including defective
Chunbo He et al.
EMBO reports, 20(3) (2019-02-14)
Dysfunction of the homeostasis-maintaining systems in specific cell types or tissues renders the organism susceptible to a range of diseases, including cancers. One of the emerging mechanisms for maintaining tissue homeostasis is cellular senescence. Here, we report that the Hippo

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique