Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU055711

Sigma-Aldrich

MISSION® esiRNA

targeting human RBX1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCAGGAACCACATTATGGATCTTTGCATAGAATGTCAAGCTAACCAGGCGTCCGCTACTTCAGAAGAGTGTACTGTCGCATGGGGAGTCTGTAACCATGCTTTTCACTTCCACTGCATCTCTCGCTGGCTCAAAACACGACAGGTGTGTCCATTGGACAACAGAGAGTGGGAATTCCAAAAGTATGGGCACTAGGAAAAGACTTCTTCCATCAAGCTTAATTGTTTTGTTATTCATTTAATGACTTTCCCTGCTGTTACCTAATTACAAATTGGATGGAACTGTGTTTTTTTCTGCTTTGTTTTTTCAGTTTGCTGTTTCTGTAGCCATATTGTATTCTGTGTCAAATAAAGTCCAGTTGGATTCTGGAACGGATG

Numéro d'accès Ensembl | humain

ENSG00000100387

Numéro d'accès NCBI

NM_014248

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... RBX1(9978) , RBX1(9978)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tomohiro Kunishige et al.
Oncology letters, 20(3), 2919-2927 (2020-08-13)
Ring box protein-1 (RBX1) is an essential component of the S-phase kinase-associated protein, Cullin and F-box containing ubiquitin ligases. Overexpression of RBX1 has been reported in several cancer types; however, little is known regarding the prognostic value and role of
Kazuhiro Migita et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 17(4), 601-609 (2013-12-03)
RING box protein-1 (RBX1) is an essential component of the E3 ubiquitin ligase Skp1/Cullin/RBX1/F-box protein complex. Although an altered expression of RBX1 has been reported in several human cancers, the role of RBX1 in gastric cancer remains unknown. We investigated
Fan Yao et al.
Nature communications, 9(1), 2269-2269 (2018-06-13)
Dysregulation of YAP localization and activity is associated with pathological conditions such as cancer. Although activation of the Hippo phosphorylation cascade is known to cause cytoplasmic retention and inactivation of YAP, emerging evidence suggests that YAP can be regulated in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique