Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU054421

Sigma-Aldrich

MISSION® esiRNA

targeting human NACC1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCCGGCTGAACTTATCAACCAGATTGGGAACCGCTGCCACCCCAAGCTCTACGACGAGGGCGACCCCTCTGAGAAGCTGGAGCTGGTGACAGGCACCAACGTGTACATCACAAGGGCGCAGCTGATGAACTGCCACGTCAGCGCAGGCACGCGGCACAAGGTCCTACTGCGGCGGCTCCTGGCCTCCTTCTTTGACCGGAACACGCTGGCCAACAGCTGCGGCACCGGCATCCGCTCTTCTACCAACGATCCCCGTCGGAAGCCCCTGGACAGCCGCGTGCTCCACGCTGTCAAGTACTACTGCCAGAACTTCGCCCCCAACTTCAAGGAGAGCGAGATGAATGCCATCGCGGCCGACATGTGCACCAACGCCCGCCGCGTCGTGCGCAAGAGCTGGATGCCCAAGGTCAAGGTGCTCAAGGCTGAGGATGACGCCTACACCACCTTC

Numéro d'accès Ensembl | humain

ENSG00000160877

Numéro d'accès NCBI

NM_052876

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NACC1(112939) , NACC1(112939)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hong-Fang Tao et al.
Oncology reports, 45(2), 469-480 (2021-01-09)
Long non‑coding RNA (lncRNA) forkhead box P4 antisense RNA 1 (FOXP4‑AS1) has been determined to function as an oncogene in various types of cancer. However, the biological function and the underlying mechanisms of FOXP4‑AS1 in mantle cell lymphoma (MCL) remain to be uncovered. The
Kohei Morita et al.
Cancers, 10(10) (2018-09-27)
The nucleus accumbens-associated protein 1 (NACC1) is a transcription factor constitutively expressed in the urothelium, where it regulates cell growth, senescence, autophagy, and epithelial-mesenchymal transition. microRNA (miRNA) constitutes a class of small non-coding RNAs which are involved in cell proliferation
Xiao-Han Tang et al.
Cancer medicine, 8(14), 6426-6436 (2019-09-07)
Heparin-binding epidermal growth factor-like growth factor (HB-EGF) is a new promising target for the treatment of ovarian cancer. Our previous study showed that cross-reacting material 197 (CRM197), a specific HB-EGF inhibitor, significantly reverses resistance against paclitaxel in paclitaxel-resistant ovarian cancer

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique