Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU053361

Sigma-Aldrich

MISSION® esiRNA

targeting human ADORA2B

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AATGAAAGCTGCTGCCTTGTGAAGTGTCTCTTTGAGAATGTGGTCCCCATGAGCTACATGGTATATTTCAATTTCTTTGGGTGTGTTCTGCCCCCACTGCTTATAATGCTGGTGATCTACATTAAGATCTTCCTGGTGGCCTGCAGGCAGCTTCAGCGCACTGAGCTGATGGACCACTCGAGGACCACCCTCCAGCGGGAGATCCATGCAGCCAAGTCACTGGCCATGATTGTGGGGATTTTTGCCCTGTGCTGGTTACCTGTGCATGCTGTTAACTGTGTCACTCTTTTCCAGCCAGCTCAGGGTAAAAATAAGCCCAAGTGGGCAATGAATATGGCCATTCTTCTGTCACATGCCAATTCAGTTGTCAATCCCATTGTCTATGCTTACCGGAACCGAG

Numéro d'accès Ensembl | humain

ENSG00000170425

Numéro d'accès NCBI

NM_000676

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ADORA2B(136) , ADORA2B(136)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Alisha Wehdnesday Bernardo Reyes et al.
Veterinary microbiology, 242, 108586-108586 (2020-03-04)
Brucella as a stealthy intracellular pathogen avoids activation of innate immune response. Here we investigated the contribution of an adenosine receptor, Adora2b, during Brucella infection in professional phagocyte RAW 264.7 cells and in a murine model. Adora2b-deficient cells showed attenuated
Max Wilkat et al.
International journal of cancer, 147(1), 202-217 (2019-12-18)
Adenosine is a signaling molecule that exerts dual effects on tumor growth: while it inhibits immune cell function and thereby prevents surveillance by the immune system, it influences tumorigenesis directly via activation of adenosine receptors on tumor cells at the
J S Long et al.
Oncogene, 34(40), 5152-5162 (2015-02-11)
Tumour cells often acquire the ability to escape cell death, a key event leading to the development of cancer. In almost half of all human cancers, the capability to induce cell death is reduced by the mutation and inactivation of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique