Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU049441

Sigma-Aldrich

MISSION® esiRNA

targeting human MSH6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
249.00 CHF
50 μG
443.00 CHF

249.00 CHF


Date d'expédition estimée le27 mars 2025



Sélectionner une taille de conditionnement

Changer de vue
20 μG
249.00 CHF
50 μG
443.00 CHF

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

249.00 CHF


Date d'expédition estimée le27 mars 2025


Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGTGAACTGGGGCTGGTATTCATGAAAGGCAACTGGGCCCATTCTGGCTTTCCTGAAATTGCATTTGGCCGTTATTCAGATTCCCTGGTGCAGAAGGGCTATAAAGTAGCACGAGTGGAACAGACTGAGACTCCAGAAATGATGGAGGCACGATGTAGAAAGATGGCACATATATCCAAGTATGATAGAGTGGTGAGGAGGGAGATCTGTAGGATCATTACCAAGGGTACACAGACTTACAGTGTGCTGGAAGGTGATCCCTCTGAGAACTACAGTAAGTATCTTCTTAGCCTCAAAGAAAAAGAGGAAGATTCTTCTGGCCATACTCGTGCATATGGTGTGTGCTTTGTTGATACTTCACTGGGAAAGTTTTTCATAGGTCAGTTTTCAGATGATCGCCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Fumi Higuchi et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(7), 1690-1699 (2020-01-05)
Emergence of mismatch repair (MMR) deficiency is a frequent mechanism of acquired resistance to the alkylating chemotherapeutic temozolomide (TMZ) in gliomas. Poly(ADP-ribose) polymerase inhibitors (PARPi) have been shown to potentiate TMZ cytotoxicity in several cancer types, including gliomas. We tested
Daniel J McGrail et al.
Cancer cell, 37(3), 371-386 (2020-02-29)
Deficient DNA mismatch repair (dMMR) induces a hypermutator phenotype that can lead to tumorigenesis; however, the functional impact of the high mutation burden resulting from this phenotype remains poorly explored. Here, we demonstrate that dMMR-induced destabilizing mutations lead to proteome
Sarah J Young et al.
Cell reports, 33(3), 108289-108289 (2020-10-22)
MutSα and MutSβ play important roles in DNA mismatch repair and are linked to inheritable cancers and degenerative disorders. Here, we show that MSH2 and MSH3, the two components of MutSβ, bind SLX4 protein, a scaffold for the assembly of

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique