Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU046211

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF2C

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTCGGGCTACTTTGGAATGTCATCCACTTACTATGACTGATCCTATCGAAGAGCACAGAATATGTGTCTGTGTTAGGAAACGCCCACTGAATAAGCAAGAATTGGCCAAGAAAGAAATTGATGTGATTTCCATTCCTAGCAAGTGTCTCCTCTTGGTACATGAACCCAAGTTGAAAGTGGACTTAACAAAGTATCTGGAGAACCAAGCATTCTGCTTTGACTTTGCATTTGATGAAACAGCTTCGAATGAAGTTGTCTACAGGTTCACAGCAAGGCCACTGGTACAGACAATCTTTGAAGGTGGAAAAGCAACTTGTTTTGCATATGGCCAGACAGGAAGTGGCAAGACACATACTATGGGCGGAGACCTCTCTGGGAAAGCCCAGAATGCATCCAAAGGGAT

Numéro d'accès Ensembl | humain

ENSG00000142945

Numéro d'accès NCBI

NM_006845

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KIF2C(11004) , KIF2C(11004)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
QCS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Haibo Wang et al.
Oncotarget, 8(30), 48671-48687 (2017-04-19)
Defects in resolving kinetochore-microtubule attachment mistakes during mitosis is linked to chromosome instability associated with carcinogenesis as well as resistance to cancer therapy. Here we report for the first time that tumor suppressor p53-binding protein 1 (53BP1) is phosphorylated at
Ashley Mooneyham et al.
Molecular cancer research : MCR, 17(2), 370-383 (2018-10-17)
UNC-45A, a highly conserved member of the UCS (UNC45A/CRO1/SHE4P) protein family of cochaperones, plays an important role in regulating cytoskeletal-associated functions in invertebrates and mammalian cells, including cytokinesis, exocytosis, cell motility, and neuronal development. Here, for the first time, UNC-45A
Chenyu Li et al.
Scientific reports, 6, 18773-18773 (2016-01-07)
Nucleolar and spindle-associated protein (NuSAP) is a microtubule-associated protein that functions as a microtubule stabiliser. Depletion of NuSAP leads to severe mitotic defects, however the mechanism by which NuSAP regulates mitosis remains elusive. In this study, we identify the microtubule
Rui-Chao Chai et al.
Carcinogenesis, 40(10), 1229-1239 (2019-06-04)
1p/19q codeletion, which leads to the abnormal expression of 1p19q genes in oligodendroglioma, is associated with chemosensitivity and favorable prognosis. Here, we aimed to explore the clinical implications of 1p19q gene expression in 1p/19q non-codel gliomas. We analyzed expression of
Hengyi Shao et al.
Scientific reports, 5, 12204-12204 (2015-07-25)
Chromosome segregation in mitosis is orchestrated by the dynamic interactions between the kinetochore and spindle microtubules. The microtubule depolymerase mitotic centromere-associated kinesin (MCAK) is a key regulator for an accurate kinetochore-microtubule attachment. However, the regulatory mechanism underlying precise MCAK depolymerase
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique