Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU042421

Sigma-Aldrich

MISSION® esiRNA

targeting human PIK3C3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAGCCAAGCATTGTTGAAGGGTGATAAGTCTGTCAGAGTTATGCGTTCTTTGCTGGCTGCACAACAGACATTTGTAGATCGGTTGGTGCATCTAATGAAGGCAGTACAACGCGAAAGTGGAAATCGTAAGAAAAAGAATGAGAGACTACAGGCATTGCTTGGAGATAATGAAAAGATGAATTTGTCAGATGTGGAACTTATCCCGTTGCCTTTAGAACCCCAAGTGAAAATTAGAGGAATAATTCCGGAAACAGCTACACTGTTTAAAAGTGCCCTTATGCCTGCACAGTTGTTTTTTAAGACGGAAGATGGAGGCAAATATCCAGTTATATTTAAGCATGGAGATGATTTACGTCAAGATCAACTTATTCTTCAAATCATTTCACTCATGGACAAGCTGTTACGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Pierre-Luc Mouchel et al.
Cancers, 12(10) (2020-10-16)
Dendrogenin A (DDA), a mammalian cholesterol metabolite with tumor suppressor properties, has recently been shown to exhibit strong anti-leukemic activity in acute myeloid leukemia (AML) cells by triggering lethal autophagy. Here, we demonstrated that DDA synergistically enhanced the toxicity of
Harilaos Filippakis et al.
Scientific reports, 8(1), 14161-14161 (2018-09-23)
Tuberous Sclerosis Complex (TSC), a rare genetic disorder with mechanistic target of rapamycin complex 1 (mTORC1) hyperactivation, is characterized by multi-organ hamartomatous benign tumors including brain, skin, kidney, and lung (Lymphangioleiomyomatosis). mTORC1 hyperactivation drives metabolic reprogramming including glucose and glutamine
María Cecilia Gimenez et al.
Journal of virology, 95(6) (2020-12-29)
Infectious bursal disease virus (IBDV) is the archetypal member of the family Birnaviridae and the etiological agent of Gumboro disease, a highly contagious immunosuppressive infection of concern to the global poultry sector for its adverse health effects in chicks. Unlike
Jian-Kang Chen et al.
The Journal of clinical investigation, 125(6), 2429-2444 (2015-05-20)
Kidney size adaptively increases as mammals grow and in response to the loss of 1 kidney. It is not clear how kidneys size themselves or if the processes that adapt kidney mass to lean body mass also mediate renal hypertrophy
Asma Boukhalfa et al.
Nature communications, 11(1), 294-294 (2020-01-17)
Cells subjected to stress situations mobilize specific membranes and proteins to initiate autophagy. Phosphatidylinositol-3-phosphate (PI3P), a crucial lipid in membrane dynamics, is known to be essential in this context. In addition to nutriments deprivation, autophagy is also triggered by fluid-flow

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique