Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU041281

Sigma-Aldrich

MISSION® esiRNA

targeting human BATF2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTAAGCTCAGTGCCCTCCAGCCCAGCCTCACGGCCCAAACTGCCCCTCCACAGCCCCTCGAGCTGGAGCATCCCACCAGAGGGAAGCTGGGGTCCTCTCCCGACAACCCTTCCTCTGCCCTGGGGCTTGCACGTCTGCAGAGCAGGGAGCACAAACCTGCTCTCTCAGCAGCCACTTGGCAAGGGCTGGTTGTGGATCCCAGCCCTCACCCTCTCCTGGCCTTTCCTCTGCTCTCCTCTGCTCAAGTCCACTTCTAACCTGGTCTTCGGAGCTGGGTTGGCCCCTTCTTTGGGCTCAGGAAGCAGCCTTAGCACACGGGCCTCTCCTCCCTCACTACTGGGTGCTGCCCTGCGTGGCTGACCAGCTGGCCCAGGATTTCACAGTCGAAAAGGAAGCCACCACTGATG

Numéro d'accès Ensembl | humain

ENSG00000168062

Numéro d'accès NCBI

NM_138456

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... BATF2(116071) , BATF2(116071)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yinghui Huang et al.
Cancer letters, 373(1), 57-66 (2016-01-26)
Dexamethasone (Dex) has been commonly used in lymphoma and leukemia treatment, but the detailed mechanisms are not fully understood. Suppressor of AP-1 regulated by interferon (SARI) has tumor-selective growth inhibitory effect. However, it's unclear whether SARI is involved in the
Sugata Roy et al.
Journal of immunology (Baltimore, Md. : 1950), 194(12), 6035-6044 (2015-05-10)
Basic leucine zipper transcription factor Batf2 is poorly described, whereas Batf and Batf3 have been shown to play essential roles in dendritic cell, T cell, and B cell development and regulation. Batf2 was drastically induced in IFN-γ-activated classical macrophages (M1)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique