Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU037321

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTGGCATACTGGGAGGAGAAGACGAGAGTGGGGAGGCTCTACTGTGTCCAGGAGCCCTCTCTGGATATCTTCTATGATCTACCTCAGGGGAATGGCTTTTGCCTCGGACAGCTCAATTCGGACAACAAGAGTCAGCTGGTGCAGAAGGTGCGGAGCAAAATCGGCTGCGGCATCCAGCTGACGCGGGAGGTGGATGGTGTGTGGGTGTACAACCGCAGCAGTTACCCCATCTTCATCAAGTCCGCCACACTGGACAACCCGGACTCCAGGACGCTGTTGGTACACAAGGTGTTCCCCGGTTTCTCCATCAAGGCTTTCGACTACGAGAAGGCGTACAGCCTGCAGCGGCCCAATGACCACGAGTTTATGCAGCAGCCGTGGACGGGCTTTACCGTGCAGATCAGCTTTG

Numéro d'accès Ensembl | humain

ENSG00000101665

Numéro d'accès NCBI

NM_005904

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SMAD7(4092) , SMAD7(4092)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

R B Luwor et al.
Oncogene, 32(19), 2433-2441 (2012-07-04)
Transforming Growth Factor-β (TGF-β) and Epidermal Growth Factor (EGF) signaling pathways are both independently implicated as key regulators in tumor formation and progression. Here, we report that the tumor-associated overexpression of epidermal growth factor receptor (EGFR) desensitizes TGF-β signaling and
Lili Du et al.
Cardiology, 138(1), 55-62 (2017-06-02)
Eplerenone (EPL), an antagonist of the mineralocorticoid receptor, is beneficial for atrial fibrillation and atrial fibrosis. However, the underlying mechanism remains less well known. We aimed to investigate the effect of EPL on atrial fibrosis using a mouse with selective
Ratana Lim et al.
Biology of reproduction, 97(2), 288-301 (2017-10-19)
Preterm birth continues to be a significant public health problem. Infection (bacterial and or viral) and inflammation, by stimulating proinflammatory cytokines, adhesion molecules, and matrix metalloproteinase 9 (MMP9), play a central role in the rupture of membranes and myometrial contractions.
Takashi Emori et al.
Biology open, 1(3), 247-260 (2012-12-06)
Smad family proteins are essential intracellular mediators that regulate transforming growth factor-β (TGF-β) ligand signaling. In response to diverse stimuli, Smad7 is rapidly expressed and acts as a cytoplasmic inhibitor that selectively interferes with signals elicited from TGF-β family receptors.
L K Zhuang et al.
Cell death & disease, 7, e2203-e2203 (2016-04-23)
MicroRNA (miRNA) and long non-coding RNA (lncRNA) have been demonstrated to participate in the progression of many cancers. Hepatocellular carcinoma (HCC) is one of the most common and aggressive malignant tumors worldwide, while the molecular mechanisms underlying HCC tumorigenesis are
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique