Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU034321

Sigma-Aldrich

MISSION® esiRNA

targeting human CP

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAATGGACTGTCCCCAAAGAAGTAGGACCCACTAATGCAGATCCTGTGTGTCTAGCTAAGATGTATTATTCTGCTGTGGAACCCACTAAAGATATATTCACTGGGCTTATTGGGCCAATGAAAATATGCAAGAAAGGAAGTTTACATGCAAATGGGAGACAGAAAGATGTAGACAAGGAATTCTATTTGTTTCCTACAGTATTTGATGAGAATGAGAGTTTACTCCTGGAAGATAATATTAGAATGTTTACAACTGCACCTGATCAGGTGGATAAGGAAGATGAAGACTTTCAGGAATCTAATAAAATGCACTCCATGAATGGATTCATGTATGGGAATCAGCCGGGTCTCACTATGTGCAAAGGAGATTCGGTCGTGTGGTACTTATTCAGCGCCGGAAATGAGGCCGATGTACATGGAATATACTTTTCAGGAAACACATATCTGTGGAGAGGAGAACGGAGAGACACAGC

Numéro d'accès Ensembl | humain

ENSG00000047457

Numéro d'accès NCBI

NM_000096

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CP(1356) , CP(1356)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yi Zhang et al.
Experimental cell research, 358(2), 234-241 (2017-07-01)
Neddylation inhibitor Pevonedistat (MLN4924) is a novel anticancer drug and has demonstrated broad-spectrum anticancer activity. Nevertheless, we found that Pevonedistat had only a modest apoptotic effect in osteosarcoma (OS) cells. Moreover, we noted that inhibition of neddylation by Pevonedistat led
Pei-Wen Wang et al.
International journal of molecular sciences, 20(18) (2019-09-25)
Wilson's disease (WD) is an autosomal recessive disorder of copper metabolism caused by defects in the ATPase gene (ATP7B). The various clinical features result from the massive accumulation of copper in the liver, cornea and basal ganglia. Although WD can
H-L Huang et al.
Oncogenesis, 6(7), e359-e359 (2017-07-12)
MUC1-C overexpression has been associated with the progression of pancreatic tumors by promoting the aggressive and metastatic phenotypes. As MUC1 is a STAT3 target gene, STAT3 plays a major role in regulating MUC1-C expression. In this study, we report an
Gang Liu et al.
Cell death & disease, 10(10), 688-688 (2019-09-20)
CELF6, a member of the CELF family of RNA-binding proteins, regulates muscle-specific alternative splicing and contributes to the pathogenesis of myotonic dystrophy (DM), however the role of CELF6 in cancer cell proliferation is less appreciated. Here, we show that the
Seong Hye Park et al.
Oncogene, 39(1), 136-150 (2019-08-30)
Hypoxia, or the deficiency of oxygen, in solid tumors is majorly responsible for the progression of cancer and remains unaffected by chemotherapy, but still requires definitive definition of the hypoxia signaling. Hypoxia disrupts the complete folding of mitochondrial proteins, leading
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique