Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU034241

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC13A2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTTCAGCCTGCACTCTTTCCCCTCCTGGGCACAGTCCAACACCACAGCCCAGTGCCTGCCAAGCCTGGCCAACACCACCACACCAAGCCCCTAGGCTGGGGCACAGCCTGGCCATGCCCAGGAAGACCCACCCCATTCCCACTCCTCTGAGCCCGGAGGGGACACCCCAAGCTCCAAGCTCCAAGCTCCAGGCCAAAGGCTGAAAGGCACGTGTGTACATAATCTCTTGCGTGTCTGTAAGGAAGGGGTGTATGCTCAGTTTCCTATGTGCTGGAATAAAAGGTGTGTGCATGTGTGTGTGCGCATATGTGTGCGCCTGCATGGATGTGAGGGGTGTGTGACGTGAGGCTATCTGAGGGGGGCTGTGTGCATGCACATGATCCTAGGTATGTATGTTGGACAGTGCACACGTGTGTGTTCACAGACAATACAACATGCCCTCTCTGGTGCCCCAGGTCTTGGTATCCCCAGCT

Numéro d'accès Ensembl | humain

ENSG00000007216

Numéro d'accès NCBI

NM_003984

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SLC13A2(9058) , SLC13A2(9058)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Neil R Hackett et al.
PloS one, 6(5), e18378-e18378 (2011-05-17)
The human airway epithelium consists of 4 major cell types: ciliated, secretory, columnar and basal cells. During natural turnover and in response to injury, the airway basal cells function as stem/progenitor cells for the other airway cell types. The objective
Lynne Bingle et al.
Histochemistry and cell biology, 138(5), 749-758 (2012-07-07)
Although the biology the PLUNC (recently renamed BPI fold, BPIF) family of secreted proteins is poorly understood, multiple array based studies have suggested that some are differentially expressed in lung diseases. We have examined the expression of BPIFB1 (LPLUNC1), the
Lynne Bingle et al.
Respiratory research, 8, 79-79 (2007-11-09)
Short PLUNC1 (SPLUNC1) is the founding member of a family of proteins (PLUNCS) expressed in the upper respiratory tract and oral cavity, which may function in host defence. It is one of the most highly expressed genes in the upper
Lynne Bingle et al.
Respiratory research, 7, 61-61 (2006-04-08)
The Whey Acidic Protein domain is an evolutionarily conserved motif found in a number of proteins, the best studied of which are antiproteinases involved in the innate immune defence of multiple epithelia. We recently characterised the WFDC2 gene which encodes
Loren Masterson et al.
Journal of skin cancer, 2014, 596459-596459 (2014-03-19)
Due to the rarity of Merkel cell carcinoma (MCC), prospective clinical trials have not been practical. This study aimed to identify biomarkers with prognostic significance. While sixty-two patients were identified who were treated for MCC at our institution, only seventeen

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique