Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU034191

Sigma-Aldrich

MISSION® esiRNA

targeting human S100A9

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGCTGGAACGCAACATAGAGACCATCATCAACACCTTCCACCAATACTCTGTGAAGCTGGGGCACCCAGACACCCTGAACCAGGGGGAATTCAAAGAGCTGGTGCGAAAAGATCTGCAAAATTTTCTCAAGAAGGAGAATAAGAATGAAAAGGTCATAGAACACATCATGGAGGACCTGGACACAAATGCAGACAAGCAGCTGAGCTTCGAGGAGTTCATCATGCTGATGGCGAGGCTAACCTGGGCCTCCCACGAGAAGATGCACGAGGGTGACGAGGGCCCTGGCCACCACCATAAGCCAGGCCTCGGGGAGGGCACCCCCTAAGACCACAGTGGCCAAGATCACAGTGGCCACGGCCACGGCCACAGTCATGGTGGCCACGGCCACAGCCACTAATCAGGAGGCCAGGCCACCCTGCCTCTACCCAACCAGGGCCCCGGGGCCTGTTATGTCAAACTGTCTTGGCTGTGG

Numéro d'accès Ensembl | humain

ENSG00000163220

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... S100A9(6280) , S100A9(6280)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yiwen Zhou et al.
Frontiers in pharmacology, 12, 640521-640521 (2021-04-02)
Hepatic macrophages play a critical role in inflammation caused by alcohol feeding. During this process, variation of macrophage phenotypes triggers inflammatory responses in a variety of ways. Moreover, there is increasing evidence that Brain and Muscle Arnt-Like Protein-1 (Bmal1) is
Liang Peng et al.
Frontiers in cellular and infection microbiology, 10, 47-47 (2020-03-03)
Bacterial infection remains one of the leading causes of death worldwide due to the continuous rise of multiple antibiotic-resistant bacteria. Focusing solely on bacteria as the drug targets is a major limitation inherent in the conventional antibiotic therapy. Recently, host-directed
Ping Wu et al.
Oncology research, 25(9), 1479-1488 (2017-03-10)
Hypopharyngeal cancer (HPC) frequently presents at an advanced stage and displays early submucosal spread, resulting in a poor prognosis. It is among the worst of all cancers in the head and neck subsites. Therefore, detection of HPC at an earlier
Hirokazu Ohata et al.
Cell reports, 28(5), 1282-1295 (2019-08-01)
Cancer stem cells (CSCs) are associated with the refractory nature of cancer, and elucidating the targetable pathways for CSCs is crucial for devising innovative antitumor therapies. We find that the proliferation of CSC-enriched colon spheroids from clinical specimen is dependent
Young Lan Seo et al.
The Journal of general virology, 96(Pt 4), 822-832 (2014-12-24)
Infection with hepatitis C virus (HCV) is characterized by systemic oxidative stress that is caused by either viral core protein or chronic inflammation. It is well recognized that reactive oxygen species (ROS) such as H2O2 can induce apoptotic cell death
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique