Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU034001

Sigma-Aldrich

MISSION® esiRNA

targeting human CNN1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTGTTCTCAGCGTCAGTGCCGCCACTGCCCCCGCCAGAGCCCACCGGCCAGCATGTCCTCTGCTCACTTCAACCGAGGCCCTGCCTACGGGCTGTCAGCCGAGGTTAAGAACAAGCTGGCCCAGAAGTATGACCACCAGCGGGAGCAGGAGCTGAGAGAGTGGATCGAGGGGGTGACAGGCCGTCGCATCGGCAACAACTTCATGGACGGCCTCAAAGATGGCATCATTCTTTGCGAATTCATCAATAAGCTGCAGCCAGGCTCCGTGAAGAAGATCAATGAGTCAACCCAAAATTGGCACCAGCTGGAGAACATCGGCAACTTCATCAAGGCCATCACCAAGTATGGGGTGAAGCCCCACGACATTTTTGAGGCCAACGACCTGTTTGAGAACACCAACCATACACAGGTGCAGTCCACCCTCCTGGCTTTGGCCAGCATGGCGAAGACGAAAGGAAACAAGGTGAACGTGG

Numéro d'accès Ensembl | humain

ENSG00000130176

Numéro d'accès NCBI

NM_001299

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CNN1(1264) , CNN1(1264)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zheng Wang et al.
Aging, 12(2), 1867-1887 (2020-01-28)
Breast cancer has been the second most prevalent and fatal malignancy due to its frequent metastasis to other organs. We aim to study the effects of a key miRNA-mRNA signaling in breast cancer. CNN1 was identified as the key gene
Kai-Hung Wang et al.
Oncotarget, 8(37), 61133-61145 (2017-10-06)
Increasing evidence indicates that ovarian high-grade serous carcinoma (HGSC) originates from the fallopian tube epithelium and metastasizes to the ovary as the secondary site. A working hypothesis is that detached tubal HGSC cells survive anoikis and implant on the ovary.
Janhavi Moharil et al.
PloS one, 10(10), e0141365-e0141365 (2015-10-28)
Stem cell differentiation involves multiple cascades of transcriptional regulation that govern the cell fate. To study the real-time dynamics of this complex process, quantitative and high throughput live cell assays are required. Herein, we developed a lentiviral library of promoters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique