Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU033921

Sigma-Aldrich

MISSION® esiRNA

targeting human TUFM

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAAGGGAGACGAGTGTGAGCTCCTAGGACATAGCAAGAACATCCGCACTGTGGTGACAGGCATTGAGATGTTCCACAAGAGCCTGGAGAGGGCCGAGGCCGGAGATAACCTCGGGGCCCTGGTCCGAGGCTTGAAGCGGGAGGACTTGCGGCGGGGCCTGGTCATGGTCAAGCCAGGTTCCATCAAGCCCCACCAGAAGGTGGAGGCCCAGGTTTACATCCTCAGCAAGGAGGAAGGTGGCCGCCACAAGCCCTTTGTGTCCCACTTCATGCCTGTCATGTTCTCCCTGACTTGGGACATGGCCTGTCGGATTATCCTGCCCCCAGAGAAGGAGCTTGCCATGCCCGGGGAGGACCTGAAGTTCAACCTAATCTTGCGGCAGCCAATGATCTTAGAGAAAGGCCAGCGTTTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaoyuan Weng et al.
Oncology letters, 20(5), 250-250 (2020-10-01)
Gastrointestinal stromal tumors (GISTs) are the most common pathologic type of mesenchymal tumor in the digestive tract. Patients with GIST face the risk of metastasis, postoperative recurrence and imatinib mesylate (IM) resistance. Mitochondrial Tu translation elongation factor (TUFM) is highly
Keiichi Tamai et al.
Scientific reports, 10(1), 21592-21592 (2020-12-11)
Cancer stem cells (CSCs) define a subpopulation of cancer cells that are resistant to therapy. However, little is known of how CSC characteristics are regulated. We previously showed that dormant cancer stem cells are enriched with a CD274low fraction of
Dasol Kim et al.
Communications biology, 4(1), 1-1 (2021-01-06)
Disorders of autophagy, a key regulator of cellular homeostasis, cause a number of human diseases. Due to the role of autophagy in metabolic dysregulation, there is a need to identify autophagy regulators as therapeutic targets. To address this need, we

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique