Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU031481

Sigma-Aldrich

MISSION® esiRNA

targeting human USP14

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAGCAGATGCTCTTCCAGAAGAACCCTCAGCCAAAACTGTCTTCGTAGAAGACATGACAGAAGAACAGTTAGCATCTGCTATGGAGTTACCATGTGGATTGACAAACCTTGGTAACACTTGTTACATGAATGCCACAGTTCAGTGTATTCGTTCTGTGCCTGAACTCAAAGATGCCCTTAAAAGGTATGCAGGTGCCTTGAGAGCTTCAGGGGAAATGGCTTCAGCGCAGTATATTACTGCAGCCCTTAGAGATTTGTTTGATTCCATGGATAAAACTTCTTCCAGTATTCCACCTATTATTCTACTGCAGTTTTTGCACATGGCTTTCCCACAGTTTGCCGAGAAAGGTGAACAAGGACAGTATCTTCAACAGGATGCTAATGAATGTTGGATACAAATGATGCGAGTATTGCAACAGAAATTGGAAGCAATAGAGGATGATTCTGTTAAAGAGACAGACTCCTCATCTGCATCGG

Numéro d'accès Ensembl | humain

ENSG00000101557

Numéro d'accès NCBI

NM_001037334

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... USP14(9097) , USP14(9097)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ying Zhu et al.
Oncotarget, 8(30), 48725-48736 (2016-07-28)
Vimentin plays important roles in the epithelial-to-mesenchymal transition (EMT). In this study, we found that vimentin was highly expressed in human gastric cancer (GC) tissues and cell lines and significantly promoted cell growth, migration and invasion. Ubiquitin-specific protease 14 (USP14)
Vignesh Srinivasan et al.
iScience, 23(1), 100790-100790 (2020-01-07)
USP14 is a deubiquitinating enzyme associated with the proteasome important for protein degradation. Here we show that upon proteasome inhibition or expression of the mutant W58A-USP14, association of USP14 with the 19S regulatory particle is disrupted. MS-based interactomics revealed an
Susu Guo et al.
Cell death & disease, 12(1), 42-42 (2021-01-09)
The regulation of homeostasis in the Ubiquitin (Ub) proteasome system (UPS) is likely to be important for the development of liver cancer. Tribbles homolog 2 (TRIB2) is known to affect Ub E3 ligases (E3s) in liver cancer. However, whether TRIB2

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique