Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU029361

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC25A28

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGGAGTCCTTGGCTTTGAACTCACACATTACAGGACATATCACAGGCATGGCTAGTGCCTTCAGGACGGTATATCAAGTAGGTGGGGTGACCGCCTATTTCCGAGGGGTGCAGGCCAGAGTAATTTACCAGATCCCCTCCACAGCCATCGCATGGTCTGTGTATGAGTTCTTCAAATACCTAATCACTAAAAGGCAAGAAGAGTGGAGGGCTGGCAAGTGAAGTAGCACTGAACGAAGCCAGGGGTTCAGATGACACTGCTGCATCCTGGTCACATTCTCTGTCTCCTGGAATGCTCCCACCTCAAGTGGAGTTAGAAGGAAGGTAGAGGGGCTCTCCCCCAGGATTTTGGTGTTTTGACTAACACCAGTTCCTGCCAACCTCTGTTGCCACCACCTTTCCTTCCAGGCCCTAAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Changfeng Li et al.
Developmental cell, 46(4), 441-455 (2018-08-14)
Pancreatic cancer is an aggressive malignancy with changes in the tumor microenvironment. Here, we demonstrate that PINK1 and PARK2 suppressed pancreatic tumorigenesis through control of mitochondrial iron-dependent immunometabolism. Using mouse models of spontaneous pancreatic cancer, we show that depletion of Pink1 and Park2
Chunlei Wang et al.
European journal of medical research, 19, 49-49 (2014-09-27)
Among glioma treatment strategies, arsenic trioxide (As2O3) has shown efficacy as a therapeutic agent against human gliomas. However, the exact antitumor mechanism of action of As2O3 is still unclear. Mitochondria are considered to be the major source of intracellular reactive
Zili Zhang et al.
Redox biology, 36, 101619-101619 (2020-08-31)
Ferroptosis is a recently discovered form of programmed cell death, but its regulatory mechanisms are not fully understood. In the current study, we reported that the BRD7-P53-SLC25A28 axis played a crucial role in regulating ferroptosis in hepatic stellate cells (HSCs).

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique