Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU018231

Sigma-Aldrich

MISSION® esiRNA

targeting human SP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCGCTCCCAACTTACAGAACCAGCAAGTTCTGACAGGACTACCTGGAGTGATGCCTAATATTCAGTATCAAGTAATCCCACAGTTCCAGACCGTTGATGGGCAACAGCTGCAGTTTGCTGCCACTGGGGCCCAAGTGCAGCAGGATGGTTCTGGTCAAATACAGATCATACCAGGTGCAAACCAACAGATTATCACAAATCGAGGAAGTGGAGGCAACATCATTGCTGCTATGCCAAACCTACTCCAGCAGGCTGTCCCCCTCCAAGGCCTGGCTAATAATGTACTCTCAGGACAGACTCAGTATGTGACCAATGTACCAGTGGCCCTGAATGGGAACATCACCTTGCTACCTGTCAACAGCGTTTCTGCAGCTACCTTGACTCCCAGCTCTCAGGCAGTCACGATCAGCAGCTCTGGGTCCCAGGAGAGTGGCTCACAGCCTGTCACCTCAGGGACTACCATCAGTTCTGCCAGCTTGGTATCATCACAAGCCAGTTCCAGCT

Numéro d'accès Ensembl | humain

ENSG00000185591

Numéro d'accès NCBI

NM_138473

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SP1(6667) , SP1(6667)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
PCV
OVT
QCS
UCT
XXS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lili Lv et al.
Oncology research, 26(5), 775-783 (2017-12-16)
Cervical cancer is the third most commonly diagnosed malignancy and the fourth leading cause of cancer-related deaths in women worldwide. MicroRNA-296 (miR-296) is aberrantly expressed in a variety of human cancer types. However, the expression levels, biological roles, and underlying
Im-Kyung Kim et al.
Scientific reports, 9(1), 5933-5933 (2019-04-13)
Specific protein 1 (SP1) is associated with aggressive behavior, invasive clinical phenotype and poor clinical outcomes in various cancers. We studied whether SP1 exerts its effect on invasiveness and promotion of the epithelial-mesenchymal transition (EMT) by regulating lysyl oxidase-like 2
Qiang Cai et al.
American journal of translational research, 8(10), 4068-4081 (2016-11-11)
Gallbladder cancer (GBC) is one of the most lethal cancers with poor prognosis. In this study, we report that the long non-coding RNA LINC00152 is significantly upregulated in GBC tissues and cell lines. The high LINC00152 levels correlated positively with
Jie Qi et al.
Journal of diabetes research, 2020, 2308520-2308520 (2020-03-19)
Cyclooxygenase 2 (COX2) and inducible nitric oxide synthase (iNOS) overexpression results in endothelial apoptosis, thus mediating vascular endothelial injury in hyperglycaemia. E26 transformation-specific sequence transcription factor-1 (ESE-1), which belongs to the E26 transformation-specific family of transcription factors, has been demonstrated
Xuefeng Pan et al.
Molecular therapy. Nucleic acids, 22, 38-49 (2020-09-11)
Emerging studies indicate that long noncoding RNAs (lncRNAs) play crucial roles in ovarian cancer (OC). By analyzing high-throughput data, we found that SNHG17 was highly expressed in multiple OC cohorts. However, its functions in OC were not explored. In this
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique