Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU016301

Sigma-Aldrich

MISSION® esiRNA

targeting human TPCN1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGATGATGCCCTCCTACTCCCGGAACCCCTGGTCCTGCGTCTTCTTCATCGTGTACCTCTCCATCGAGCTGTATTTCATCATGAACCTGCTTCTGGCTGTGGTGTTCGACACCTTCAATGACATTGAGAAACGCAAGTTCAAGTCTTTGCTACTGCACAAGCGAACCGCTATCCAGCATGCCTACCGCCTGCTCATCAGCCAGAGGAGGCCTGCCGGCATCTCCTACAGGCAGTTTGAAGGCCTCATGCGCTTCTACAAGCCCCGGATGAGTGCCAGGGAGCGCTATCTTACCTTCAAGGCCCTGAATCAGAACAACACACCCCTGCTCAGCCTAAAGGACTTTTACGATATCTACGAAGTTGCTGCTTTGAAGTGGAAGGCCAAGAAAAACAGAGAGCACTGGTTTGATGAGCTTCCCAGGACGGCGCTCCTCATCTTCAAAGGTATTAATATCCTTGTGAAGTCCAAGGCCTTCCAGTATTTCATGTACTTGGTGGTGGCAGTCAA

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Francesco Moccia et al.
Journal of cellular physiology, 236(1), 688-705 (2020-06-26)
Nicotinic acid adenine dinucleotide phosphate (NAADP) is the most recently discovered Ca2+ -releasing messenger that increases the intracellular Ca2+ concentration by mobilizing the lysosomal Ca2+ store through two-pore channels 1 (TPC1) and 2 (TPC2). NAADP-induced lysosomal Ca2+ release regulates multiple
Pawan Faris et al.
Cancers, 11(4) (2019-04-18)
Nicotinic acid adenine dinucleotide phosphate (NAADP) gates two-pore channels 1 and 2 (TPC1 and TPC2) to elicit endo-lysosomal (EL) Ca2+ release. NAADP-induced EL Ca2+ signals may be amplified by the endoplasmic reticulum (ER) through the Ca2+-induced Ca2+ release mechanism (CICR).

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique