Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU015511

Sigma-Aldrich

MISSION® esiRNA

targeting human PLG

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTTCCACTTCTCCCCACAGACCTAGATTCTCACCTGCTACACACCCCTCAGAGGGACTGGAGGAGAACTACTGCAGGAATCCAGACAACGATCCGCAGGGGCCCTGGTGCTATACTACTGATCCAGAAAAGAGATATGACTACTGCGACATTCTTGAGTGTGAAGAGGAATGTATGCATTGCAGTGGAGAAAACTATGACGGCAAAATTTCCAAGACCATGTCTGGACTGGAATGCCAGGCCTGGGACTCTCAGAGCCCACACGCTCATGGATACATTCCTTCCAAATTTCCAAACAAGAACCTGAAGAAGAATTACTGTCGTAACCCCGATAGGGAGCTGCGGCCTTGGTGTTTCACCACCGACCCCAACAAGCGCTGGGAACTTTGTGACATCCCCCGCTGCACAACACCTCCACCATCTTCTGG

Numéro d'accès Ensembl | humain

ENSG00000122194

Numéro d'accès NCBI

NM_000301

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PLG(5340) , PLG(5340)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
QCS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lan-Zhi Wang et al.
Developmental and comparative immunology, 106, 103598-103598 (2019-12-28)
Interleukin 18 (IL-18), a member of IL-1 cytokine superfamily, is an important proinflammatory cytokine with multiple functions in both innate immunity and acquired immunity. However, the characteristics and functional roles of IL-18 remain largely unknown in amphibians, which were classed
Liuping Wei et al.
Cellular signalling, 26(7), 1476-1488 (2014-03-25)
We have established that 15-hydroxyeicosatetraenoic acid is an important factor in regulation of pulmonary vascular remodeling (PVR) associated with hypoxia-induced pulmonary hypertension (PH), which is further metabolized by 15-hydroxyprostaglandin dehydrogenase (15-PGDH) to form 15-ketoeicosatetraenoic acid (15-KETE). However, the role of
Uttam Satyal et al.
ACS applied materials & interfaces, 9(35), 29481-29495 (2017-08-16)
This article presents the synthesis, self-assembly, and biological activity as transfection agents for pDNA, siRNA, and mRNA of novel pyridinium pseudogemini surfactants, interfacially engineered from the most efficient gemini surfactants and lipids generated in our amphiphile research program. Formulation of
Karen A Newell-Litwa et al.
The Journal of cell biology, 210(2), 225-242 (2015-07-15)
RhoGTPases organize the actin cytoskeleton to generate diverse polarities, from front-back polarity in migrating cells to dendritic spine morphology in neurons. For example, RhoA through its effector kinase, RhoA kinase (ROCK), activates myosin II to form actomyosin filament bundles and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique