Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU013041

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM4A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACTGCAGGCCAGAAAGTCATTAGCAAGCATAAGAACGGGCGCTTCTACCAGTGTGAAGTGGTCAGGCTCACCACCGAGACCTTCTATGAAGTCAACTTTGATGATGGCTCCTTCAGCGACAATCTTTATCCTGAGGACATAGTGAGCCAGGACTGTCTCCAGTTTGGTCCTCCTGCTGAAGGGGAAGTGGTCCAAGTGAGATGGACAGACGGCCAAGTCTATGGAGCCAAGTTTGTGGCCTCCCACCCTATCCAAATGTACCAGGTGGAGTTTGAGGATGGCTCACAACTTGTGGTTAAGAGAGATGATGTATACACACTGGATGAAGAGCTTCCCAAGAGAGTCAAATCTAGACTGTCAGTAGCCTCAGACATGCGCTTCAATGAGATTTTCACAGAGAAAGAGGTTAAGCAAGAAAAGAAACGGCAA

Numéro d'accès Ensembl | humain

ENSG00000066135

Numéro d'accès NCBI

NM_014663

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KDM4A(9682) , JMJD2A(9682)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yi Su et al.
BMC cancer, 17(1), 477-477 (2017-07-12)
Jumonji C domain 2A (JMJD2A), as a histone demethylases, plays a vital role in tumorigenesis and progression. But, its functions and underlying mechanisms of JMJD2A in nasopharyngeal carcinoma (NPC) metabolism are remained to be clarified. In this study, we investigated
Antonio Pezone et al.
Nucleic acids research, 48(16), 8943-8958 (2020-07-23)
The epithelial-to-mesenchymal transition (EMT) is a complex transcriptional program induced by transforming growth factor β1 (TGF-β1). Histone lysine-specific demethylase 1 (LSD1) has been recognized as a key mediator of EMT in cancer cells, but the precise mechanism that underlies the
Haiyu Zhang et al.
Archives of biochemistry and biophysics, 684, 108334-108334 (2020-03-17)
Emerging evidence shows that histone modification and its related regulators are involved in the progression and chemoresistance of ovarian cancer (OC) cells. Our present study found that the expression of Jumonji C domain-containing 2A (JMJD2A), while not JMJD2B or JMJD2C
Tadahiko Nakagawa et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 23(3), 426-436 (2019-11-05)
Jumonji domain-containing protein 2A (JMJD2A) of the JMJD2 family of histone lysine demethylases has been implicated in tumorigenesis. However, its expression and role in gastric cancer (GC) drug resistance remain unknown. Here, we investigated the role of JMJD2A in GC

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique