Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU011891

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF168

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TATCTCGGCTTCTCCCTTGAATTCCAGAAAATCTGATCCAGTTACACCCAAGTCTGAAAAGAAAAGTAAGAACAAACAAAGAAACACTGGAGATATTCAGAAGTATTTGACACCGAAATCTCAGTTTGGGTCAGCCTCACACTCTGAAGCTGTACAAGAAGTCAGGAAAGACTCCGTATCTAAGGACATTGACAGTAGTGATAGGAAAAGCCCAACAGGGCAAGACACAGAAATAGAAGATATGCCGACACTTTCTCCACAGATATCCCTTGGAGTTGGAGAACAAGGTGCAGATTCTTCAATAGAGTCCCCTATGCCATGGTTATGTGCCTGTGGTGCCGAATGGTACCATGAAGGAAACGTCAAAACAAGACCAAGCAATCATGGGAAAGAGTTATGTGTCTTAAGTCACGAGCGACCTAAAACCAGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Stanimir Dulev et al.
Cell cycle (Georgetown, Tex.), 19(1), 15-23 (2019-11-26)
The DNA damage response (DDR) associated post-translational modifications recruit chromatin remodelers, signaling proteins such as 53BP1 and repair factors to chromatin flanking DNA double strand breaks (DSBs) to promote its repair. Although localization of both RNF168 ubiquitin ligase and SET8
Parasvi S Patel et al.
The Journal of clinical investigation, 131(3) (2021-02-03)
Germline mutations in BRCA1 and BRCA2 (BRCA1/2) genes considerably increase breast and ovarian cancer risk. Given that tumors with these mutations have elevated genomic instability, they exhibit relative vulnerability to certain chemotherapies and targeted treatments based on poly (ADP-ribose) polymerase

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique