Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU009491

Sigma-Aldrich

MISSION® esiRNA

targeting human ZC3H12A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACAGTGTTTGTGCCATCCTGGAGGAAGGAGCAGCCTCGGCCCGACGTGCCCATCACAGACCAGCACATCCTGCGGGAACTGGAGAAGAAGAAGATCCTGGTGTTCACACCATCACGACGCGTGGGTGGCAAGCGGGTGGTGTGCTATGACGACAGATTCATTGTGAAGCTGGCCTACGAGTCTGACGGGATCGTGGTTTCCAACGACACATACCGTGACCTCCAAGGCGAGCGGCAGGAGTGGAAGCGCTTCATCGAGGAGCGGCTGCTCATGTACTCCTTCGTCAATGACAAGTTTATGCCCCCTGATGACCCACTGGGCCGGCACGGGCCCAGCCTGGACAACTTCCTGCGTAAGAAGCCACTCACTTTGGAGCACAGGAAGCAGCCGTGTCCCTATGGAAGGAAATGCACCTATGGGATCAAGTGCCGAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhuqing Jin et al.
International journal of molecular sciences, 20(1) (2019-01-10)
MCP-1-induced protein (MCPIP, also known as Zc3h12a or Regnase-1), a newly identified suppressor of cytokine signaling, is expressed in endothelial cells (ECs). To investigate the role of endothelial MCPIP in vascular homeostasis and function, we deleted the MCPIP gene specifically
Min Li et al.
Medical microbiology and immunology, 207(1), 27-38 (2017-10-19)
Monocyte chemotactic protein-induced protein 1(MCPIP1) is identified as an important inflammatory regulator during immune response. MCPIP1 possesses antiviral activities against several viruses, such as Japanese encephalitis. However, its role on Coxsackievirus B3 (CVB3) infection, a positive-stranded RNA virus, has not
You-Take Oh et al.
Oncogene, 37(25), 3415-3425 (2018-03-20)
Monocyte chemotactic protein-induced protein-1 (MCPIP1; also called Regnase-1) encoded by the ZC3H12A gene critically regulates inflammatory responses and immune homeostasis primarily by RNase-dependent and -independent mechanisms. However, the relationship of MCPIP1 with apoptosis and cancer and the underlying mechanisms are
Nidhi Kapoor et al.
Journal of immunology (Baltimore, Md. : 1950), 194(12), 6011-6023 (2015-05-03)
Macrophage polarization plays a critical role in tissue homeostasis, disease pathogenesis, and inflammation and its resolution. IL-4-induced macrophage polarization involves induction of STAT6 and Krüppel-like factor 4 (KLF4), which induce each other and promote M2 polarization. However, how these transcription

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique