Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU008861

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF10A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACAGCAATGGGAACATAGCCCTTTGGGAGAGTTGTGTCCACCAGGATCTCATAGATCAGAACATCCTGGAGCCTGTAACCGGTGCACAGAGGGTGTGGGTTACACCAATGCTTCCAACAATTTGTTTGCTTGCCTCCCATGTACAGCTTGTAAATCAGATGAAGAAGAGAGAAGTCCCTGCACCACGACCAGGAACACAGCATGTCAGTGCAAACCAGGAACTTTCCGGAATGACAATTCTGCTGAGATGTGCCGGAAGTGCAGCAGAGGGTGCCCCAGAGGGATGGTCAAGGTCAAGGATTGTACGCCCTGGAGTGACATCGAGTGTGTCCACAAAGAATCAGGCAATGGACATAATATATGGGTGATTTTGGTTGTGACTTTGGTTGTTCCGTTGCTGTTGGTGGCTGTGCTGATTGTCTGTTGTTGCATCGGCTCAGGTTGTGGAGGGGACCCCAAGTGCATGGACAGGGTGTGTTTCTGGCGCTTGGGTCTCCTACGAGGGCCTGGGGCTGAGGACAATGCTCACAA

Numéro d'accès Ensembl | humain

ENSG00000104689

Numéro d'accès NCBI

NM_003844

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TNFRSF10A(8797) , TNFRSF10A(8797)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yitong Yang et al.
The international journal of biochemistry & cell biology, 97, 62-72 (2018-02-13)
Persistent infection with hepatitis B virus (HBV) may lead to HBV-associated glomerulonephritis (HBV-GN). Presence of HBV-DNA and -RNA in renal tubular epithelial cells (RTECs) suggests direct virus-induced injury. Increase in proinflammatory cytokines is also observed under these conditions. Apoptosis by
Yuyou Deng et al.
International journal of biological sciences, 15(3), 688-700 (2019-02-13)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is an effective chemotherapeutic agent that specifically impairs cancer cells while sparing normal cells; however, some cancer cells develop resistance to TRAIL. Here, we identified Andrographolide, a diterpenoid lactone derived from a traditional herbal
Bo Ram Kim et al.
Oncogene, 38(20), 3903-3918 (2019-01-30)
RUNX3 is frequently inactivated by DNA hypermethylation in numerous cancers. Here, we show that RUNX3 has an important role in modulating apoptosis in immediate response to tumor necrosis factor-related apoptosis-including ligand (TRAIL). Importantly, no combined effect of TRAIL and RUNX3
Jae Young Jang et al.
PloS one, 9(6), e98171-e98171 (2014-06-14)
Hepatitis C virus (HCV) infection causes chronic liver diseases leading to hepatocellular carcinoma (HCC) and liver failure. We have previously shown that HCV sensitizes hepatocytes to mitochondrial apoptosis via the TRAIL death receptors DR4 and DR5. Although TRAIL and its
Mamoru Akita et al.
International journal of oncology, 45(5), 1901-1912 (2014-09-02)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a promising candidate for cancer treatment, but some cancer cell types are resistant to TRAIL cytotoxicity. Therefore, overcoming this resistance is necessary for effective TRAIL therapy. Mitochondrial morphology is important for the maintenance

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique