Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU007531

Sigma-Aldrich

MISSION® esiRNA

targeting human CDCA5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCTTGAAAACGGAGCTGGATGAGTGGGCTGCGGCCATGAATGCCGAGTTTGAAGCTGCTGAGCAGTTTGATCTCCTGGTTGAATGAGATGCAGTGGGGGGTGCACCTGGCCAGACTCTCCCTCCTGTCCTGTACATAGCCACCTCCCTGTGGAGAGGACACTTAGGGTCCCCTCCCCTGGTCTTGTTACCTGTGTGTGTGCTGGTGCTGCGCATGAGGACTGTCTGCCTTTGAGGGCTTGGGCAGCAGCGGCAGCCATCTTGGTTTTAGGAAATGGGGCCGCCTGGCCCAGCCACTCACTGGTGTCCTGTCTCTTGTCGTCCTGTCCTTCCTATCTCCCCAAAGTACCATAGCCAGTTTCCAGATGGGCCACAGACTGGGGAGGAGAATCAGTGGCCCAGCCAGAAGTTAAAGGGCTGAGGGTTGAGGTGAGAG

Numéro d'accès Ensembl | humain

ENSG00000146670

Numéro d'accès NCBI

NM_080668

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CDCA5(113130) , CDCA5(113130)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jianlin Wang et al.
Oncology reports, 40(4), 1875-1884 (2018-07-18)
Cell division cycle associated 5 (CDCA5) has been associated with the progression of several types of cancers. However, its possible role and mechanism in hepatocellular carcinoma (HCC) remain unknown. In the present study, immunohistochemical staining and real‑time PCR were used to
Tatsuya Kato et al.
International journal of oncology, 49(6), 2411-2420 (2016-11-15)
Malignant pleural mesothelioma (MPM) is an aggressive type of cancer of the thoracic cavity commonly associated with asbestos exposure and a high mortality rate. There is a need for new molecular targets for the development of more effective therapies for
Chun-Jie Huang et al.
In vitro cellular & developmental biology. Animal, 53(3), 258-264 (2016-11-09)
Maintenance and timely termination of cohesion on chromosomes ensures accurate chromosome segregation to guard against aneuploidy in mammalian oocytes and subsequent chromosomally abnormal pregnancies. Sororin, a cohesion stabilizer whose relevance in antagonizing the anti-cohesive property of Wings-apart like protein (Wapl)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique